Incidental Mutation 'R4659:Nwd1'
ID352682
Institutional Source Beutler Lab
Gene Symbol Nwd1
Ensembl Gene ENSMUSG00000048148
Gene NameNACHT and WD repeat domain containing 1
SynonymsA230063L24Rik
MMRRC Submission 041919-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R4659 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location72646711-72717876 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 72695321 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 998 (D998E)
Ref Sequence ENSEMBL: ENSMUSP00000124804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093427] [ENSMUST00000160443] [ENSMUST00000161254] [ENSMUST00000161557] [ENSMUST00000228312]
Predicted Effect probably benign
Transcript: ENSMUST00000093427
AA Change: D998E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091135
Gene: ENSMUSG00000048148
AA Change: D998E

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
Pfam:AAA_16 312 457 7.3e-8 PFAM
Pfam:NACHT 336 511 1.3e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 985 2e-15 BLAST
WD40 988 1028 2.05e1 SMART
Blast:WD40 1037 1073 2e-9 BLAST
Blast:WD40 1073 1110 4e-10 BLAST
WD40 1118 1156 5.97e-1 SMART
WD40 1160 1198 6.6e1 SMART
WD40 1245 1283 5.3e1 SMART
WD40 1286 1326 2.13e1 SMART
WD40 1340 1375 1.06e2 SMART
WD40 1377 1416 3.5e-4 SMART
WD40 1421 1461 2.66e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160443
SMART Domains Protein: ENSMUSP00000124446
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160912
Predicted Effect probably benign
Transcript: ENSMUST00000161254
AA Change: D998E

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000124804
Gene: ENSMUSG00000048148
AA Change: D998E

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
low complexity region 319 329 N/A INTRINSIC
Pfam:NACHT 336 511 2.1e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 985 1e-15 BLAST
WD40 988 1028 2.05e1 SMART
Blast:WD40 1037 1073 2e-9 BLAST
Blast:WD40 1073 1110 3e-10 BLAST
WD40 1118 1156 2.49e-1 SMART
WD40 1203 1241 5.3e1 SMART
WD40 1244 1284 2.13e1 SMART
WD40 1298 1333 1.06e2 SMART
WD40 1335 1374 3.5e-4 SMART
WD40 1379 1419 2.66e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161386
SMART Domains Protein: ENSMUSP00000123737
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
low complexity region 279 292 N/A INTRINSIC
low complexity region 319 329 N/A INTRINSIC
Pfam:NACHT 336 511 1.2e-12 PFAM
WD40 857 896 1.31e-3 SMART
WD40 899 938 7.97e-8 SMART
Blast:WD40 941 984 1e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000161557
SMART Domains Protein: ENSMUSP00000125470
Gene: ENSMUSG00000048148

DomainStartEndE-ValueType
low complexity region 45 55 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162248
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163026
Predicted Effect probably benign
Transcript: ENSMUST00000228312
AA Change: D1039E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.4245 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is thought to be a cytosolic protein and predicted to contain a NACHT domain and multiple WD40 repeats. Increased expression of this gene was observed in some prostate cancer cell lines. Knocking down expression of this gene results in decreased androgen receptor protein levels, indicating that this gene may be important in modulating androgen receptor activity. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,216,276 probably benign Het
Abcc9 C A 6: 142,672,595 probably null Het
Ankrd22 C T 19: 34,125,568 V118I probably damaging Het
Aoc1 A T 6: 48,906,076 E295D probably benign Het
Arap2 T C 5: 62,654,126 N1114S possibly damaging Het
AU021092 C G 16: 5,212,147 A335P probably damaging Het
Carhsp1 T C 16: 8,664,265 T51A probably benign Het
Ccdc144b T C 3: 36,025,954 D218G possibly damaging Het
Cdc42bpb T C 12: 111,339,891 D152G probably damaging Het
Cep70 T A 9: 99,296,341 D497E possibly damaging Het
Chrm5 T C 2: 112,479,757 N338S probably benign Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clhc1 T A 11: 29,578,229 *586K probably null Het
Dopey1 T A 9: 86,502,032 probably benign Het
Dync1h1 T C 12: 110,628,767 F1371S possibly damaging Het
Eif6 A G 2: 155,826,181 I46T probably damaging Het
Esco2 G A 14: 65,826,586 T383M possibly damaging Het
Exoc8 T C 8: 124,897,532 D32G probably damaging Het
Fam149b G T 14: 20,367,873 S216I probably benign Het
Fam219a T C 4: 41,521,645 D87G probably null Het
Fbxw26 A T 9: 109,744,871 V71D probably damaging Het
Gabra4 T A 5: 71,641,144 K164M probably damaging Het
Gm8603 G A 17: 13,517,028 noncoding transcript Het
Gnmt A G 17: 46,725,966 F239S probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Kcnj1 A T 9: 32,394,148 D2V probably benign Het
Limch1 C T 5: 67,027,557 R797C probably damaging Het
Lrrc9 T A 12: 72,470,264 F597I probably damaging Het
Lrriq3 T A 3: 155,129,453 I275N possibly damaging Het
Mcoln1 T A 8: 3,510,840 S387R probably damaging Het
Mgst3 T A 1: 167,377,279 Q58L probably damaging Het
Mical1 G A 10: 41,486,936 probably benign Het
Mmp3 C A 9: 7,453,673 D431E probably benign Het
Mx1 T C 16: 97,455,239 probably null Het
Myo7a A G 7: 98,085,466 L607P probably damaging Het
Myt1l A G 12: 29,849,457 N153D probably damaging Het
Nfu1 A T 6: 87,019,426 T120S probably damaging Het
Nhlrc2 T C 19: 56,576,267 V341A possibly damaging Het
Notch1 T C 2: 26,470,889 E1148G probably damaging Het
Nqo1 C T 8: 107,391,044 probably null Het
Olfr1049 G A 2: 86,255,013 Q227* probably null Het
Oxct2a T C 4: 123,322,680 I303V probably benign Het
Parp10 A T 15: 76,242,985 D58E probably damaging Het
Pcdha6 T A 18: 36,969,239 V495E probably damaging Het
Pitrm1 T A 13: 6,553,182 S88R probably benign Het
Pxdn T C 12: 29,994,553 V510A probably benign Het
Ranbp17 T A 11: 33,266,288 D820V probably damaging Het
Sec24c G T 14: 20,683,144 G180C probably damaging Het
Serpina3n T C 12: 104,413,493 S382P probably benign Het
Sestd1 A T 2: 77,212,499 M237K probably null Het
Sf3a2 T C 10: 80,803,584 I136T probably damaging Het
Sh3tc2 A G 18: 61,974,509 Y197C probably benign Het
Speer4b T C 5: 27,497,895 K204E probably benign Het
Speer4f1 A C 5: 17,476,223 E33A possibly damaging Het
Sspo T A 6: 48,484,213 D3529E probably damaging Het
Stard13 T C 5: 151,062,788 D419G probably benign Het
Tg A G 15: 66,673,920 S164G possibly damaging Het
Thap12 A G 7: 98,710,091 probably benign Het
Thsd1 C A 8: 22,259,298 Y667* probably null Het
Tnks A C 8: 34,849,311 Y885D possibly damaging Het
Ttll3 A G 6: 113,414,141 I896V probably benign Het
Txnip T G 3: 96,559,427 F190C probably damaging Het
Urb1 T C 16: 90,776,129 D1005G probably damaging Het
Usp3 T C 9: 66,527,070 probably null Het
Usp54 G T 14: 20,564,992 Q794K probably damaging Het
Xrn2 A G 2: 147,061,474 Q798R probably benign Het
Zfp189 A G 4: 49,530,342 I482V probably benign Het
Zfp28 A G 7: 6,393,507 N314D probably benign Het
Zmym4 A G 4: 126,948,428 probably null Het
Other mutations in Nwd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Nwd1 APN 8 72671077 missense probably damaging 0.99
IGL01294:Nwd1 APN 8 72711745 missense probably damaging 1.00
IGL01298:Nwd1 APN 8 72662331 missense probably benign 0.00
IGL01333:Nwd1 APN 8 72666811 missense possibly damaging 0.90
IGL01371:Nwd1 APN 8 72675115 missense probably damaging 1.00
IGL02244:Nwd1 APN 8 72707582 missense probably damaging 1.00
IGL02579:Nwd1 APN 8 72707527 missense probably damaging 1.00
IGL02608:Nwd1 APN 8 72667375 missense probably damaging 1.00
IGL02632:Nwd1 APN 8 72667454 missense possibly damaging 0.80
IGL02893:Nwd1 APN 8 72667501 missense probably damaging 1.00
IGL03010:Nwd1 APN 8 72688060 splice site probably benign
R0017:Nwd1 UTSW 8 72709425 splice site probably benign
R0066:Nwd1 UTSW 8 72711856 missense probably benign 0.27
R0066:Nwd1 UTSW 8 72711856 missense probably benign 0.27
R0505:Nwd1 UTSW 8 72662337 missense probably damaging 0.96
R0511:Nwd1 UTSW 8 72682005 missense probably damaging 1.00
R0612:Nwd1 UTSW 8 72667680 missense probably damaging 0.99
R0681:Nwd1 UTSW 8 72662337 missense probably damaging 0.96
R0763:Nwd1 UTSW 8 72671044 missense probably damaging 1.00
R0905:Nwd1 UTSW 8 72709449 missense probably damaging 0.99
R1136:Nwd1 UTSW 8 72697769 splice site probably benign
R1483:Nwd1 UTSW 8 72657086 missense probably damaging 0.96
R1630:Nwd1 UTSW 8 72667029 missense possibly damaging 0.66
R1724:Nwd1 UTSW 8 72711620 missense probably damaging 1.00
R1732:Nwd1 UTSW 8 72666835 missense possibly damaging 0.96
R1885:Nwd1 UTSW 8 72704994 missense probably benign 0.00
R1973:Nwd1 UTSW 8 72704962 missense possibly damaging 0.46
R2393:Nwd1 UTSW 8 72662427 missense probably benign
R2926:Nwd1 UTSW 8 72667012 missense probably damaging 1.00
R3706:Nwd1 UTSW 8 72667116 missense possibly damaging 0.66
R3916:Nwd1 UTSW 8 72667811 nonsense probably null
R3917:Nwd1 UTSW 8 72667811 nonsense probably null
R4153:Nwd1 UTSW 8 72681936 missense probably damaging 1.00
R4426:Nwd1 UTSW 8 72666795 missense probably damaging 1.00
R4435:Nwd1 UTSW 8 72688136 missense possibly damaging 0.46
R4522:Nwd1 UTSW 8 72670951 missense probably damaging 1.00
R4622:Nwd1 UTSW 8 72667300 missense probably damaging 1.00
R4694:Nwd1 UTSW 8 72667330 missense probably damaging 1.00
R4837:Nwd1 UTSW 8 72657131 missense probably damaging 1.00
R4844:Nwd1 UTSW 8 72667114 missense probably damaging 1.00
R4906:Nwd1 UTSW 8 72672213 missense probably damaging 1.00
R5041:Nwd1 UTSW 8 72705055 missense possibly damaging 0.90
R5183:Nwd1 UTSW 8 72671086 missense probably benign 0.07
R5416:Nwd1 UTSW 8 72666694 missense possibly damaging 0.90
R5553:Nwd1 UTSW 8 72704976 missense possibly damaging 0.83
R5670:Nwd1 UTSW 8 72693117 missense probably damaging 0.97
R5699:Nwd1 UTSW 8 72702974 critical splice donor site probably null
R5722:Nwd1 UTSW 8 72675244 missense probably damaging 0.97
R5762:Nwd1 UTSW 8 72670914 missense probably damaging 1.00
R5778:Nwd1 UTSW 8 72693117 missense probably damaging 0.97
R5992:Nwd1 UTSW 8 72653573 critical splice donor site probably null
R6163:Nwd1 UTSW 8 72662186 missense probably damaging 0.96
R6164:Nwd1 UTSW 8 72662186 missense probably damaging 0.96
R6165:Nwd1 UTSW 8 72662186 missense probably damaging 0.96
R6212:Nwd1 UTSW 8 72695322 missense possibly damaging 0.95
R6443:Nwd1 UTSW 8 72662366 missense possibly damaging 0.58
R6865:Nwd1 UTSW 8 72657062 missense possibly damaging 0.63
R6928:Nwd1 UTSW 8 72682025 missense probably benign 0.27
R6944:Nwd1 UTSW 8 72653534 missense possibly damaging 0.69
R6979:Nwd1 UTSW 8 72667660 missense probably damaging 1.00
R7060:Nwd1 UTSW 8 72666694 missense probably damaging 1.00
R7102:Nwd1 UTSW 8 72695329 missense probably damaging 1.00
R7265:Nwd1 UTSW 8 72692928 missense probably benign 0.29
R7343:Nwd1 UTSW 8 72711782 missense probably damaging 0.98
R7391:Nwd1 UTSW 8 72662418 missense probably damaging 0.99
R7424:Nwd1 UTSW 8 72675173 missense possibly damaging 0.86
R7438:Nwd1 UTSW 8 72707830 missense probably benign 0.00
R7487:Nwd1 UTSW 8 72666638 missense unknown
R7502:Nwd1 UTSW 8 72707393 missense probably damaging 0.98
R7883:Nwd1 UTSW 8 72667126 missense probably damaging 1.00
R7966:Nwd1 UTSW 8 72667126 missense probably damaging 1.00
X0067:Nwd1 UTSW 8 72667256 missense possibly damaging 0.81
Z1176:Nwd1 UTSW 8 72672300 missense not run
Z1177:Nwd1 UTSW 8 72666628 missense probably damaging 0.97
Z1177:Nwd1 UTSW 8 72695387 missense possibly damaging 0.48
Z1177:Nwd1 UTSW 8 72709459 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATAGGCTTGCTCTGTGCTAC -3'
(R):5'- ACTTACCAGGGCAATGGAGC -3'

Sequencing Primer
(F):5'- GCTACCTAGCTTAAGGGATAAAGCC -3'
(R):5'- TTGCCCGGGACTGGATG -3'
Posted On2015-10-08