Incidental Mutation 'R4659:Myt1l'
ID352697
Institutional Source Beutler Lab
Gene Symbol Myt1l
Ensembl Gene ENSMUSG00000061911
Gene Namemyelin transcription factor 1-like
SynonymsC630034G21Rik, Nztf1, 2900046C06Rik, 2900093J19Rik, Png-1, Pmng1
MMRRC Submission 041919-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4659 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location29528384-29923213 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 29849457 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 153 (N153D)
Ref Sequence ENSEMBL: ENSMUSP00000151919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021009] [ENSMUST00000049784] [ENSMUST00000218198] [ENSMUST00000218583]
Predicted Effect unknown
Transcript: ENSMUST00000021009
AA Change: N748D
SMART Domains Protein: ENSMUSP00000021009
Gene: ENSMUSG00000061911
AA Change: N748D

DomainStartEndE-ValueType
Pfam:zf-C2HC 28 58 8.3e-19 PFAM
coiled coil region 148 182 N/A INTRINSIC
low complexity region 188 200 N/A INTRINSIC
low complexity region 222 233 N/A INTRINSIC
Pfam:zf-C2HC 502 532 1.1e-16 PFAM
Pfam:zf-C2HC 546 576 4e-18 PFAM
Pfam:MYT1 620 872 2.7e-135 PFAM
Pfam:zf-C2HC 901 931 8.4e-20 PFAM
Pfam:zf-C2HC 950 980 1.2e-18 PFAM
Pfam:zf-C2HC 1003 1033 1.1e-17 PFAM
coiled coil region 1055 1130 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000049784
AA Change: N750D
SMART Domains Protein: ENSMUSP00000058264
Gene: ENSMUSG00000061911
AA Change: N750D

DomainStartEndE-ValueType
Pfam:zf-C2HC 30 58 5.1e-18 PFAM
coiled coil region 148 182 N/A INTRINSIC
low complexity region 188 200 N/A INTRINSIC
low complexity region 222 233 N/A INTRINSIC
Pfam:zf-C2HC 506 533 9.9e-15 PFAM
Pfam:zf-C2HC 550 578 2.4e-16 PFAM
Pfam:MYT1 622 873 2.7e-122 PFAM
Pfam:zf-C2HC 905 933 6.3e-19 PFAM
Pfam:zf-C2HC 954 982 1.6e-18 PFAM
Pfam:zf-C2HC 1007 1035 1.4e-16 PFAM
coiled coil region 1057 1132 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000218198
AA Change: N153D

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect unknown
Transcript: ENSMUST00000218583
AA Change: N748D
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220072
Meta Mutation Damage Score 0.0676 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc finger superfamily of transcription factors. The encoded protein belongs to a novel class of cystein-cystein-histidine-cystein zinc finger proteins that function in the developing mammalian central nervous system. Forced expression of this gene in combination with the basic helix-loop-helix transcription factor NeuroD1 and the transcription factors POU class 3 homeobox 2 and achaete-scute family basic helix-loop-helix transcription factor 1 can convert fetal and postnatal human fibroblasts into induced neuronal cells, which are able to generate action potentials. Mutations in this gene have been associated with autosomal mental retardation-39 and autism spectrum disorder. Alternative splicing results in multiple variants. [provided by RefSeq, Aug 2016]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,216,276 probably benign Het
Abcc9 C A 6: 142,672,595 probably null Het
Ankrd22 C T 19: 34,125,568 V118I probably damaging Het
Aoc1 A T 6: 48,906,076 E295D probably benign Het
Arap2 T C 5: 62,654,126 N1114S possibly damaging Het
AU021092 C G 16: 5,212,147 A335P probably damaging Het
Carhsp1 T C 16: 8,664,265 T51A probably benign Het
Ccdc144b T C 3: 36,025,954 D218G possibly damaging Het
Cdc42bpb T C 12: 111,339,891 D152G probably damaging Het
Cep70 T A 9: 99,296,341 D497E possibly damaging Het
Chrm5 T C 2: 112,479,757 N338S probably benign Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clhc1 T A 11: 29,578,229 *586K probably null Het
Dopey1 T A 9: 86,502,032 probably benign Het
Dync1h1 T C 12: 110,628,767 F1371S possibly damaging Het
Eif6 A G 2: 155,826,181 I46T probably damaging Het
Esco2 G A 14: 65,826,586 T383M possibly damaging Het
Exoc8 T C 8: 124,897,532 D32G probably damaging Het
Fam149b G T 14: 20,367,873 S216I probably benign Het
Fam219a T C 4: 41,521,645 D87G probably null Het
Fbxw26 A T 9: 109,744,871 V71D probably damaging Het
Gabra4 T A 5: 71,641,144 K164M probably damaging Het
Gm8603 G A 17: 13,517,028 noncoding transcript Het
Gnmt A G 17: 46,725,966 F239S probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Kcnj1 A T 9: 32,394,148 D2V probably benign Het
Limch1 C T 5: 67,027,557 R797C probably damaging Het
Lrrc9 T A 12: 72,470,264 F597I probably damaging Het
Lrriq3 T A 3: 155,129,453 I275N possibly damaging Het
Mcoln1 T A 8: 3,510,840 S387R probably damaging Het
Mgst3 T A 1: 167,377,279 Q58L probably damaging Het
Mical1 G A 10: 41,486,936 probably benign Het
Mmp3 C A 9: 7,453,673 D431E probably benign Het
Mx1 T C 16: 97,455,239 probably null Het
Myo7a A G 7: 98,085,466 L607P probably damaging Het
Nfu1 A T 6: 87,019,426 T120S probably damaging Het
Nhlrc2 T C 19: 56,576,267 V341A possibly damaging Het
Notch1 T C 2: 26,470,889 E1148G probably damaging Het
Nqo1 C T 8: 107,391,044 probably null Het
Nwd1 T A 8: 72,695,321 D998E probably benign Het
Olfr1049 G A 2: 86,255,013 Q227* probably null Het
Oxct2a T C 4: 123,322,680 I303V probably benign Het
Parp10 A T 15: 76,242,985 D58E probably damaging Het
Pcdha6 T A 18: 36,969,239 V495E probably damaging Het
Pitrm1 T A 13: 6,553,182 S88R probably benign Het
Pxdn T C 12: 29,994,553 V510A probably benign Het
Ranbp17 T A 11: 33,266,288 D820V probably damaging Het
Sec24c G T 14: 20,683,144 G180C probably damaging Het
Serpina3n T C 12: 104,413,493 S382P probably benign Het
Sestd1 A T 2: 77,212,499 M237K probably null Het
Sf3a2 T C 10: 80,803,584 I136T probably damaging Het
Sh3tc2 A G 18: 61,974,509 Y197C probably benign Het
Speer4b T C 5: 27,497,895 K204E probably benign Het
Speer4f1 A C 5: 17,476,223 E33A possibly damaging Het
Sspo T A 6: 48,484,213 D3529E probably damaging Het
Stard13 T C 5: 151,062,788 D419G probably benign Het
Tg A G 15: 66,673,920 S164G possibly damaging Het
Thap12 A G 7: 98,710,091 probably benign Het
Thsd1 C A 8: 22,259,298 Y667* probably null Het
Tnks A C 8: 34,849,311 Y885D possibly damaging Het
Ttll3 A G 6: 113,414,141 I896V probably benign Het
Txnip T G 3: 96,559,427 F190C probably damaging Het
Urb1 T C 16: 90,776,129 D1005G probably damaging Het
Usp3 T C 9: 66,527,070 probably null Het
Usp54 G T 14: 20,564,992 Q794K probably damaging Het
Xrn2 A G 2: 147,061,474 Q798R probably benign Het
Zfp189 A G 4: 49,530,342 I482V probably benign Het
Zfp28 A G 7: 6,393,507 N314D probably benign Het
Zmym4 A G 4: 126,948,428 probably null Het
Other mutations in Myt1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00490:Myt1l APN 12 29827424 missense unknown
IGL00896:Myt1l APN 12 29826886 missense unknown
IGL01653:Myt1l APN 12 29910771 missense unknown
IGL02632:Myt1l APN 12 29914293 missense unknown
IGL03088:Myt1l APN 12 29920477 missense probably benign 0.03
IGL03212:Myt1l APN 12 29827820 missense unknown
R0057:Myt1l UTSW 12 29842612 splice site probably null
R0126:Myt1l UTSW 12 29851720 missense possibly damaging 0.91
R0356:Myt1l UTSW 12 29811501 missense unknown
R0538:Myt1l UTSW 12 29842571 missense possibly damaging 0.47
R0587:Myt1l UTSW 12 29811635 missense unknown
R0629:Myt1l UTSW 12 29811485 missense unknown
R0709:Myt1l UTSW 12 29827733 missense unknown
R0736:Myt1l UTSW 12 29827814 missense unknown
R0920:Myt1l UTSW 12 29886139 missense unknown
R1618:Myt1l UTSW 12 29827397 missense unknown
R1660:Myt1l UTSW 12 29895273 missense unknown
R1716:Myt1l UTSW 12 29811538 missense unknown
R1758:Myt1l UTSW 12 29827242 missense unknown
R1852:Myt1l UTSW 12 29851661 missense probably benign 0.27
R1971:Myt1l UTSW 12 29827092 missense unknown
R2120:Myt1l UTSW 12 29783619 critical splice acceptor site probably null
R2227:Myt1l UTSW 12 29826970 missense unknown
R2865:Myt1l UTSW 12 29910789 missense probably benign 0.00
R4587:Myt1l UTSW 12 29910801 missense unknown
R4603:Myt1l UTSW 12 29842540 missense probably benign 0.01
R4734:Myt1l UTSW 12 29919926 missense possibly damaging 0.90
R4786:Myt1l UTSW 12 29811458 missense unknown
R4824:Myt1l UTSW 12 29849400 missense probably benign 0.02
R4835:Myt1l UTSW 12 29895305 missense unknown
R4888:Myt1l UTSW 12 29886139 missense unknown
R4976:Myt1l UTSW 12 29832303 missense unknown
R4980:Myt1l UTSW 12 29827039 missense unknown
R5119:Myt1l UTSW 12 29832303 missense unknown
R5194:Myt1l UTSW 12 29811648 missense unknown
R5247:Myt1l UTSW 12 29832332 missense unknown
R5249:Myt1l UTSW 12 29832332 missense unknown
R5427:Myt1l UTSW 12 29832332 missense unknown
R5428:Myt1l UTSW 12 29832332 missense unknown
R5429:Myt1l UTSW 12 29832332 missense unknown
R5431:Myt1l UTSW 12 29832332 missense unknown
R5628:Myt1l UTSW 12 29811621 missense unknown
R5926:Myt1l UTSW 12 29832332 missense unknown
R5959:Myt1l UTSW 12 29920040 critical splice donor site probably null
R6082:Myt1l UTSW 12 29832332 missense unknown
R6082:Myt1l UTSW 12 29842519 missense probably damaging 1.00
R6084:Myt1l UTSW 12 29832332 missense unknown
R6086:Myt1l UTSW 12 29832332 missense unknown
R6145:Myt1l UTSW 12 29832381 missense unknown
R6293:Myt1l UTSW 12 29827628 missense unknown
R6315:Myt1l UTSW 12 29827798 missense unknown
R6458:Myt1l UTSW 12 29895299 missense unknown
R6490:Myt1l UTSW 12 29832366 missense unknown
R6758:Myt1l UTSW 12 29842600 missense possibly damaging 0.94
R7230:Myt1l UTSW 12 29783874 missense probably damaging 0.99
R7330:Myt1l UTSW 12 29851554 missense unknown
R7545:Myt1l UTSW 12 29827088 missense unknown
R7662:Myt1l UTSW 12 29826869 missense unknown
R7744:Myt1l UTSW 12 29827549 missense unknown
U24488:Myt1l UTSW 12 29826896 missense unknown
Z1177:Myt1l UTSW 12 29811431 missense probably damaging 1.00
Z1177:Myt1l UTSW 12 29842468 missense unknown
Predicted Primers PCR Primer
(F):5'- CCAAGCGGTACTGCAAGAATG -3'
(R):5'- CTGAGACACCATAAAGACCATGGG -3'

Sequencing Primer
(F):5'- GAATGCCAGCCCCAGCAG -3'
(R):5'- ATGGCTGTGCTAATGTCCCAG -3'
Posted On2015-10-08