Incidental Mutation 'R4659:Sec24c'
ID352705
Institutional Source Beutler Lab
Gene Symbol Sec24c
Ensembl Gene ENSMUSG00000039367
Gene NameSec24 related gene family, member C (S. cerevisiae)
Synonyms2610204K03Rik
MMRRC Submission 041919-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4659 (G1)
Quality Score203
Status Validated
Chromosome14
Chromosomal Location20674308-20694852 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 20683144 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Cysteine at position 180 (G180C)
Ref Sequence ENSEMBL: ENSMUSP00000045955 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048657] [ENSMUST00000223751] [ENSMUST00000224492] [ENSMUST00000224754] [ENSMUST00000224876] [ENSMUST00000225108]
Predicted Effect probably damaging
Transcript: ENSMUST00000048657
AA Change: G180C

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045955
Gene: ENSMUSG00000039367
AA Change: G180C

DomainStartEndE-ValueType
low complexity region 28 47 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 183 194 N/A INTRINSIC
low complexity region 201 212 N/A INTRINSIC
low complexity region 256 279 N/A INTRINSIC
low complexity region 311 326 N/A INTRINSIC
Pfam:zf-Sec23_Sec24 424 462 8.2e-17 PFAM
Pfam:Sec23_trunk 501 745 7.3e-94 PFAM
Pfam:Sec23_BS 750 834 8e-20 PFAM
Pfam:Sec23_helical 847 948 2.3e-30 PFAM
Pfam:Gelsolin 963 1038 1.3e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180987
Predicted Effect probably benign
Transcript: ENSMUST00000223751
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224061
Predicted Effect probably benign
Transcript: ENSMUST00000224492
Predicted Effect probably benign
Transcript: ENSMUST00000224754
Predicted Effect probably benign
Transcript: ENSMUST00000224876
Predicted Effect probably benign
Transcript: ENSMUST00000225108
Predicted Effect unknown
Transcript: ENSMUST00000228545
AA Change: G30C
Meta Mutation Damage Score 0.1160 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SEC24 subfamily of the SEC23/SEC24 family, which is involved in vesicle trafficking. The encoded protein has similarity to yeast Sec24p component of COPII. COPII is the coat protein complex responsible for vesicle budding from the ER. The product of this gene may play a role in shaping the vesicle, as well as in cargo selection and concentration. Alternatively spliced transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display complete embryonic lethality between implantation and placentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,216,276 probably benign Het
Abcc9 C A 6: 142,672,595 probably null Het
Ankrd22 C T 19: 34,125,568 V118I probably damaging Het
Aoc1 A T 6: 48,906,076 E295D probably benign Het
Arap2 T C 5: 62,654,126 N1114S possibly damaging Het
AU021092 C G 16: 5,212,147 A335P probably damaging Het
Carhsp1 T C 16: 8,664,265 T51A probably benign Het
Ccdc144b T C 3: 36,025,954 D218G possibly damaging Het
Cdc42bpb T C 12: 111,339,891 D152G probably damaging Het
Cep70 T A 9: 99,296,341 D497E possibly damaging Het
Chrm5 T C 2: 112,479,757 N338S probably benign Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clhc1 T A 11: 29,578,229 *586K probably null Het
Dopey1 T A 9: 86,502,032 probably benign Het
Dync1h1 T C 12: 110,628,767 F1371S possibly damaging Het
Eif6 A G 2: 155,826,181 I46T probably damaging Het
Esco2 G A 14: 65,826,586 T383M possibly damaging Het
Exoc8 T C 8: 124,897,532 D32G probably damaging Het
Fam149b G T 14: 20,367,873 S216I probably benign Het
Fam219a T C 4: 41,521,645 D87G probably null Het
Fbxw26 A T 9: 109,744,871 V71D probably damaging Het
Gabra4 T A 5: 71,641,144 K164M probably damaging Het
Gm8603 G A 17: 13,517,028 noncoding transcript Het
Gnmt A G 17: 46,725,966 F239S probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Kcnj1 A T 9: 32,394,148 D2V probably benign Het
Limch1 C T 5: 67,027,557 R797C probably damaging Het
Lrrc9 T A 12: 72,470,264 F597I probably damaging Het
Lrriq3 T A 3: 155,129,453 I275N possibly damaging Het
Mcoln1 T A 8: 3,510,840 S387R probably damaging Het
Mgst3 T A 1: 167,377,279 Q58L probably damaging Het
Mical1 G A 10: 41,486,936 probably benign Het
Mmp3 C A 9: 7,453,673 D431E probably benign Het
Mx1 T C 16: 97,455,239 probably null Het
Myo7a A G 7: 98,085,466 L607P probably damaging Het
Myt1l A G 12: 29,849,457 N153D probably damaging Het
Nfu1 A T 6: 87,019,426 T120S probably damaging Het
Nhlrc2 T C 19: 56,576,267 V341A possibly damaging Het
Notch1 T C 2: 26,470,889 E1148G probably damaging Het
Nqo1 C T 8: 107,391,044 probably null Het
Nwd1 T A 8: 72,695,321 D998E probably benign Het
Olfr1049 G A 2: 86,255,013 Q227* probably null Het
Oxct2a T C 4: 123,322,680 I303V probably benign Het
Parp10 A T 15: 76,242,985 D58E probably damaging Het
Pcdha6 T A 18: 36,969,239 V495E probably damaging Het
Pitrm1 T A 13: 6,553,182 S88R probably benign Het
Pxdn T C 12: 29,994,553 V510A probably benign Het
Ranbp17 T A 11: 33,266,288 D820V probably damaging Het
Serpina3n T C 12: 104,413,493 S382P probably benign Het
Sestd1 A T 2: 77,212,499 M237K probably null Het
Sf3a2 T C 10: 80,803,584 I136T probably damaging Het
Sh3tc2 A G 18: 61,974,509 Y197C probably benign Het
Speer4b T C 5: 27,497,895 K204E probably benign Het
Speer4f1 A C 5: 17,476,223 E33A possibly damaging Het
Sspo T A 6: 48,484,213 D3529E probably damaging Het
Stard13 T C 5: 151,062,788 D419G probably benign Het
Tg A G 15: 66,673,920 S164G possibly damaging Het
Thap12 A G 7: 98,710,091 probably benign Het
Thsd1 C A 8: 22,259,298 Y667* probably null Het
Tnks A C 8: 34,849,311 Y885D possibly damaging Het
Ttll3 A G 6: 113,414,141 I896V probably benign Het
Txnip T G 3: 96,559,427 F190C probably damaging Het
Urb1 T C 16: 90,776,129 D1005G probably damaging Het
Usp3 T C 9: 66,527,070 probably null Het
Usp54 G T 14: 20,564,992 Q794K probably damaging Het
Xrn2 A G 2: 147,061,474 Q798R probably benign Het
Zfp189 A G 4: 49,530,342 I482V probably benign Het
Zfp28 A G 7: 6,393,507 N314D probably benign Het
Zmym4 A G 4: 126,948,428 probably null Het
Other mutations in Sec24c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Sec24c APN 14 20693203 missense probably benign 0.03
IGL00574:Sec24c APN 14 20692395 missense probably damaging 0.99
IGL01514:Sec24c APN 14 20682771 missense possibly damaging 0.78
IGL01924:Sec24c APN 14 20689689 missense probably damaging 0.96
IGL02094:Sec24c APN 14 20688402 missense probably damaging 1.00
IGL02677:Sec24c APN 14 20689642 missense probably damaging 0.98
IGL02871:Sec24c APN 14 20692882 missense probably benign
Kahuna UTSW 14 20690773 missense probably damaging 0.99
R0010:Sec24c UTSW 14 20689261 unclassified probably benign
R0335:Sec24c UTSW 14 20688715 intron probably null
R0487:Sec24c UTSW 14 20683399 missense probably benign 0.01
R0609:Sec24c UTSW 14 20686948 missense probably damaging 1.00
R0626:Sec24c UTSW 14 20688437 missense probably damaging 1.00
R0734:Sec24c UTSW 14 20693745 missense probably damaging 1.00
R0854:Sec24c UTSW 14 20689340 missense probably damaging 1.00
R1036:Sec24c UTSW 14 20692897 missense probably benign 0.14
R1405:Sec24c UTSW 14 20692525 splice site probably null
R1405:Sec24c UTSW 14 20692525 splice site probably null
R1702:Sec24c UTSW 14 20686573 missense probably null
R1765:Sec24c UTSW 14 20688854 unclassified probably benign
R1913:Sec24c UTSW 14 20689111 missense probably benign 0.06
R1920:Sec24c UTSW 14 20686887 missense probably damaging 0.99
R2084:Sec24c UTSW 14 20691279 missense probably benign 0.00
R3778:Sec24c UTSW 14 20683307 missense possibly damaging 0.63
R4383:Sec24c UTSW 14 20690773 missense probably damaging 0.99
R4385:Sec24c UTSW 14 20690773 missense probably damaging 0.99
R4798:Sec24c UTSW 14 20693712 missense probably damaging 1.00
R4872:Sec24c UTSW 14 20693745 missense probably damaging 1.00
R5210:Sec24c UTSW 14 20691804 missense probably damaging 1.00
R5345:Sec24c UTSW 14 20693220 missense probably benign 0.00
R5610:Sec24c UTSW 14 20691825 missense probably damaging 1.00
R5614:Sec24c UTSW 14 20682738 missense possibly damaging 0.92
R5646:Sec24c UTSW 14 20679573 missense probably benign 0.01
R6460:Sec24c UTSW 14 20690800 missense probably damaging 1.00
R7181:Sec24c UTSW 14 20689333 missense probably damaging 1.00
RF010:Sec24c UTSW 14 20688715 intron probably null
Predicted Primers PCR Primer
(F):5'- TTTGAACCCCAGATGCAGGG -3'
(R):5'- TTCACTGGAAGACTCCCAAAGC -3'

Sequencing Primer
(F):5'- CCAGATGCAGGGACAGTCTTTTG -3'
(R):5'- GGAAGACTCCCAAAGCCCTGTC -3'
Posted On2015-10-08