Incidental Mutation 'R4659:2410089E03Rik'
ID 352707
Institutional Source Beutler Lab
Gene Symbol 2410089E03Rik
Ensembl Gene ENSMUSG00000039801
Gene Name RIKEN cDNA 2410089E03 gene
Synonyms b2b012Clo
MMRRC Submission 041919-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4659 (G1)
Quality Score 225
Status Validated
Chromosome 15
Chromosomal Location 8169106-8271158 bp(+) (GRCm38)
Type of Mutation intron
DNA Base Change (assembly) G to T at 8216276 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000106247 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110617]
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082632
Predicted Effect probably benign
Transcript: ENSMUST00000110617
SMART Domains Protein: ENSMUSP00000106247
Gene: ENSMUSG00000039801

DomainStartEndE-ValueType
low complexity region 144 157 N/A INTRINSIC
low complexity region 338 352 N/A INTRINSIC
low complexity region 466 476 N/A INTRINSIC
low complexity region 868 883 N/A INTRINSIC
low complexity region 949 962 N/A INTRINSIC
low complexity region 1400 1415 N/A INTRINSIC
low complexity region 1449 1464 N/A INTRINSIC
low complexity region 1827 1838 N/A INTRINSIC
low complexity region 1919 1930 N/A INTRINSIC
low complexity region 2130 2145 N/A INTRINSIC
coiled coil region 2750 2782 N/A INTRINSIC
low complexity region 2838 2850 N/A INTRINSIC
Pfam:Joubert 2894 3207 1.9e-136 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154291
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has putative coiled-coil domains and may be a transmembrane protein. Defects in this gene are a cause of Joubert syndrome (JBTS). [provided by RefSeq, May 2012]
PHENOTYPE: Homozygotes exhibit double outlet right ventricle {SDD}, pulmonary atresia/hypolastic pulmonary artery, atrioventricular septal defect, and right aortic arch. Non-cardiovascular defects include cleft palate, polydactyly, transparent chest wall (sternal bone hypoplasia) and hypoplastic lungs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc9 C A 6: 142,672,595 probably null Het
Ankrd22 C T 19: 34,125,568 V118I probably damaging Het
Aoc1 A T 6: 48,906,076 E295D probably benign Het
Arap2 T C 5: 62,654,126 N1114S possibly damaging Het
AU021092 C G 16: 5,212,147 A335P probably damaging Het
Carhsp1 T C 16: 8,664,265 T51A probably benign Het
Ccdc144b T C 3: 36,025,954 D218G possibly damaging Het
Cdc42bpb T C 12: 111,339,891 D152G probably damaging Het
Cep70 T A 9: 99,296,341 D497E possibly damaging Het
Chrm5 T C 2: 112,479,757 N338S probably benign Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clhc1 T A 11: 29,578,229 *586K probably null Het
Dopey1 T A 9: 86,502,032 probably benign Het
Dync1h1 T C 12: 110,628,767 F1371S possibly damaging Het
Eif6 A G 2: 155,826,181 I46T probably damaging Het
Esco2 G A 14: 65,826,586 T383M possibly damaging Het
Exoc8 T C 8: 124,897,532 D32G probably damaging Het
Fam149b G T 14: 20,367,873 S216I probably benign Het
Fam219a T C 4: 41,521,645 D87G probably null Het
Fbxw26 A T 9: 109,744,871 V71D probably damaging Het
Gabra4 T A 5: 71,641,144 K164M probably damaging Het
Gm8603 G A 17: 13,517,028 noncoding transcript Het
Gnmt A G 17: 46,725,966 F239S probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Kcnj1 A T 9: 32,394,148 D2V probably benign Het
Limch1 C T 5: 67,027,557 R797C probably damaging Het
Lrrc9 T A 12: 72,470,264 F597I probably damaging Het
Lrriq3 T A 3: 155,129,453 I275N possibly damaging Het
Mcoln1 T A 8: 3,510,840 S387R probably damaging Het
Mgst3 T A 1: 167,377,279 Q58L probably damaging Het
Mical1 G A 10: 41,486,936 probably benign Het
Mmp3 C A 9: 7,453,673 D431E probably benign Het
Mx1 T C 16: 97,455,239 probably null Het
Myo7a A G 7: 98,085,466 L607P probably damaging Het
Myt1l A G 12: 29,849,457 N153D probably damaging Het
Nfu1 A T 6: 87,019,426 T120S probably damaging Het
Nhlrc2 T C 19: 56,576,267 V341A possibly damaging Het
Notch1 T C 2: 26,470,889 E1148G probably damaging Het
Nqo1 C T 8: 107,391,044 probably null Het
Nwd1 T A 8: 72,695,321 D998E probably benign Het
Olfr1049 G A 2: 86,255,013 Q227* probably null Het
Oxct2a T C 4: 123,322,680 I303V probably benign Het
Parp10 A T 15: 76,242,985 D58E probably damaging Het
Pcdha6 T A 18: 36,969,239 V495E probably damaging Het
Pitrm1 T A 13: 6,553,182 S88R probably benign Het
Pxdn T C 12: 29,994,553 V510A probably benign Het
Ranbp17 T A 11: 33,266,288 D820V probably damaging Het
Sec24c G T 14: 20,683,144 G180C probably damaging Het
Serpina3n T C 12: 104,413,493 S382P probably benign Het
Sestd1 A T 2: 77,212,499 M237K probably null Het
Sf3a2 T C 10: 80,803,584 I136T probably damaging Het
Sh3tc2 A G 18: 61,974,509 Y197C probably benign Het
Speer4b T C 5: 27,497,895 K204E probably benign Het
Speer4f1 A C 5: 17,476,223 E33A possibly damaging Het
Sspo T A 6: 48,484,213 D3529E probably damaging Het
Stard13 T C 5: 151,062,788 D419G probably benign Het
Tg A G 15: 66,673,920 S164G possibly damaging Het
Thap12 A G 7: 98,710,091 probably benign Het
Thsd1 C A 8: 22,259,298 Y667* probably null Het
Tnks A C 8: 34,849,311 Y885D possibly damaging Het
Ttll3 A G 6: 113,414,141 I896V probably benign Het
Txnip T G 3: 96,559,427 F190C probably damaging Het
Urb1 T C 16: 90,776,129 D1005G probably damaging Het
Usp3 T C 9: 66,527,070 probably null Het
Usp54 G T 14: 20,564,992 Q794K probably damaging Het
Xrn2 A G 2: 147,061,474 Q798R probably benign Het
Zfp189 A G 4: 49,530,342 I482V probably benign Het
Zfp28 A G 7: 6,393,507 N314D probably benign Het
Zmym4 A G 4: 126,948,428 probably null Het
Other mutations in 2410089E03Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00756:2410089E03Rik APN 15 8264447 splice site probably benign
IGL00766:2410089E03Rik APN 15 8252164 missense unknown
IGL01483:2410089E03Rik APN 15 8187107 missense probably damaging 0.98
IGL01520:2410089E03Rik APN 15 8221911 missense probably damaging 0.96
IGL01578:2410089E03Rik APN 15 8270710 missense unknown
IGL01701:2410089E03Rik APN 15 8203257 splice site probably benign
IGL01892:2410089E03Rik APN 15 8242265 splice site probably benign
IGL01895:2410089E03Rik APN 15 8229107 missense possibly damaging 0.63
IGL01922:2410089E03Rik APN 15 8270821 missense unknown
IGL01978:2410089E03Rik APN 15 8219382 missense probably damaging 0.98
IGL02031:2410089E03Rik APN 15 8179769 missense probably damaging 0.99
IGL02318:2410089E03Rik APN 15 8175025 missense probably damaging 0.98
IGL02321:2410089E03Rik APN 15 8216572 missense probably benign 0.04
IGL02363:2410089E03Rik APN 15 8218437 missense possibly damaging 0.68
IGL02404:2410089E03Rik APN 15 8187284 missense possibly damaging 0.48
IGL02535:2410089E03Rik APN 15 8174838 missense probably damaging 1.00
IGL02732:2410089E03Rik APN 15 8179891 missense probably benign 0.03
IGL02895:2410089E03Rik APN 15 8232107 splice site probably benign
IGL02903:2410089E03Rik APN 15 8269778 missense unknown
IGL02903:2410089E03Rik APN 15 8269779 missense unknown
IGL02979:2410089E03Rik APN 15 8218554 missense possibly damaging 0.82
IGL03077:2410089E03Rik APN 15 8212795 splice site probably benign
IGL03196:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
IGL03344:2410089E03Rik APN 15 8187458 missense possibly damaging 0.63
IGL03368:2410089E03Rik APN 15 8222373 missense probably benign 0.06
IGL03403:2410089E03Rik APN 15 8201342 missense probably damaging 0.98
agnes UTSW 15 8246938 nonsense probably null
dei UTSW 15 8186165 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0015:2410089E03Rik UTSW 15 8186184 missense probably damaging 1.00
R0101:2410089E03Rik UTSW 15 8220960 missense probably benign 0.00
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0105:2410089E03Rik UTSW 15 8187392 missense probably benign
R0165:2410089E03Rik UTSW 15 8216382 missense probably damaging 1.00
R0306:2410089E03Rik UTSW 15 8179889 missense probably damaging 1.00
R0433:2410089E03Rik UTSW 15 8216562 missense probably benign 0.00
R0491:2410089E03Rik UTSW 15 8182243 missense probably damaging 1.00
R0523:2410089E03Rik UTSW 15 8194386 missense probably damaging 1.00
R0571:2410089E03Rik UTSW 15 8259793 missense unknown
R0679:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R0704:2410089E03Rik UTSW 15 8210083 missense possibly damaging 0.93
R0707:2410089E03Rik UTSW 15 8258321 missense unknown
R0715:2410089E03Rik UTSW 15 8223092 missense probably benign 0.14
R0762:2410089E03Rik UTSW 15 8218416 unclassified probably benign
R0830:2410089E03Rik UTSW 15 8247185 missense unknown
R0924:2410089E03Rik UTSW 15 8251070 splice site probably benign
R1071:2410089E03Rik UTSW 15 8218426 missense probably benign 0.20
R1184:2410089E03Rik UTSW 15 8216487 missense probably benign
R1224:2410089E03Rik UTSW 15 8178385 missense probably benign 0.06
R1416:2410089E03Rik UTSW 15 8246938 nonsense probably null
R1428:2410089E03Rik UTSW 15 8219369 missense possibly damaging 0.83
R1487:2410089E03Rik UTSW 15 8186231 missense probably damaging 1.00
R1641:2410089E03Rik UTSW 15 8228959 missense probably benign 0.41
R1652:2410089E03Rik UTSW 15 8201146 missense probably damaging 1.00
R1688:2410089E03Rik UTSW 15 8228609 missense probably benign 0.00
R1715:2410089E03Rik UTSW 15 8226900 splice site probably null
R1820:2410089E03Rik UTSW 15 8269645 missense unknown
R1863:2410089E03Rik UTSW 15 8228593 missense probably benign 0.00
R1940:2410089E03Rik UTSW 15 8233852 missense probably damaging 0.98
R1967:2410089E03Rik UTSW 15 8203420 missense probably benign 0.09
R2064:2410089E03Rik UTSW 15 8186165 missense probably damaging 1.00
R2076:2410089E03Rik UTSW 15 8219257 missense possibly damaging 0.93
R2163:2410089E03Rik UTSW 15 8203251 splice site probably null
R2208:2410089E03Rik UTSW 15 8194403 missense probably benign 0.33
R2504:2410089E03Rik UTSW 15 8219216 missense probably damaging 0.99
R2568:2410089E03Rik UTSW 15 8201269 missense possibly damaging 0.70
R2845:2410089E03Rik UTSW 15 8216380 missense probably damaging 1.00
R2913:2410089E03Rik UTSW 15 8270685 missense unknown
R3056:2410089E03Rik UTSW 15 8251007 missense unknown
R3706:2410089E03Rik UTSW 15 8259816 missense unknown
R3707:2410089E03Rik UTSW 15 8259816 missense unknown
R3870:2410089E03Rik UTSW 15 8218464 missense probably damaging 0.98
R3877:2410089E03Rik UTSW 15 8221943 missense probably benign
R3886:2410089E03Rik UTSW 15 8171805 missense probably damaging 0.98
R4057:2410089E03Rik UTSW 15 8219025 missense probably benign 0.08
R4090:2410089E03Rik UTSW 15 8212358 splice site probably null
R4362:2410089E03Rik UTSW 15 8270745 missense unknown
R4363:2410089E03Rik UTSW 15 8270745 missense unknown
R4445:2410089E03Rik UTSW 15 8252188 missense unknown
R4581:2410089E03Rik UTSW 15 8171798 missense possibly damaging 0.85
R4587:2410089E03Rik UTSW 15 8201152 missense possibly damaging 0.50
R4663:2410089E03Rik UTSW 15 8218455 missense probably benign 0.31
R4779:2410089E03Rik UTSW 15 8218838 missense probably benign 0.04
R4812:2410089E03Rik UTSW 15 8201123 splice site probably null
R4850:2410089E03Rik UTSW 15 8262938 missense unknown
R4896:2410089E03Rik UTSW 15 8221937 missense probably benign 0.00
R5273:2410089E03Rik UTSW 15 8244341 missense probably damaging 0.98
R5273:2410089E03Rik UTSW 15 8262938 missense unknown
R5303:2410089E03Rik UTSW 15 8260690 splice site probably null
R5307:2410089E03Rik UTSW 15 8260690 splice site probably null
R5308:2410089E03Rik UTSW 15 8260690 splice site probably null
R5373:2410089E03Rik UTSW 15 8270803 missense unknown
R5374:2410089E03Rik UTSW 15 8270803 missense unknown
R5386:2410089E03Rik UTSW 15 8194413 missense probably damaging 1.00
R5534:2410089E03Rik UTSW 15 8228835 missense probably benign 0.06
R5720:2410089E03Rik UTSW 15 8203687 missense probably benign 0.35
R5891:2410089E03Rik UTSW 15 8188589 missense probably benign 0.00
R5932:2410089E03Rik UTSW 15 8244595 splice site probably null
R6053:2410089E03Rik UTSW 15 8188461 missense probably benign 0.35
R6166:2410089E03Rik UTSW 15 8186560 missense probably benign 0.00
R6245:2410089E03Rik UTSW 15 8178418 missense probably benign 0.01
R6246:2410089E03Rik UTSW 15 8210014 missense probably damaging 1.00
R6541:2410089E03Rik UTSW 15 8219295 missense possibly damaging 0.48
R6622:2410089E03Rik UTSW 15 8244222 missense probably damaging 0.98
R6707:2410089E03Rik UTSW 15 8223122 missense probably benign 0.39
R6729:2410089E03Rik UTSW 15 8188601 splice site probably null
R6805:2410089E03Rik UTSW 15 8244306 missense probably benign 0.07
R6806:2410089E03Rik UTSW 15 8186858 missense possibly damaging 0.55
R6813:2410089E03Rik UTSW 15 8229282 missense probably benign
R6830:2410089E03Rik UTSW 15 8176184 missense probably benign 0.04
R6845:2410089E03Rik UTSW 15 8221904 missense possibly damaging 0.84
R6894:2410089E03Rik UTSW 15 8187368 missense probably damaging 0.99
R6970:2410089E03Rik UTSW 15 8187548 missense probably benign 0.01
R6991:2410089E03Rik UTSW 15 8252206 missense unknown
R7003:2410089E03Rik UTSW 15 8228762 missense probably damaging 0.99
R7088:2410089E03Rik UTSW 15 8218947 missense probably benign 0.16
R7104:2410089E03Rik UTSW 15 8194444 missense possibly damaging 0.83
R7311:2410089E03Rik UTSW 15 8180915 missense probably damaging 1.00
R7374:2410089E03Rik UTSW 15 8247247 missense unknown
R7446:2410089E03Rik UTSW 15 8232080 missense probably damaging 0.98
R7539:2410089E03Rik UTSW 15 8201244 missense probably benign 0.19
R7543:2410089E03Rik UTSW 15 8225392 missense unknown
R7558:2410089E03Rik UTSW 15 8225367 missense unknown
R7629:2410089E03Rik UTSW 15 8227067 nonsense probably null
R7635:2410089E03Rik UTSW 15 8226920 missense probably benign 0.01
R7644:2410089E03Rik UTSW 15 8223127 missense probably benign 0.00
R7705:2410089E03Rik UTSW 15 8182252 missense probably damaging 1.00
R7752:2410089E03Rik UTSW 15 8269706 missense unknown
R7754:2410089E03Rik UTSW 15 8243826 missense possibly damaging 0.53
R7757:2410089E03Rik UTSW 15 8252227 missense unknown
R7836:2410089E03Rik UTSW 15 8203757 missense probably damaging 0.97
R7875:2410089E03Rik UTSW 15 8209962 missense probably benign 0.18
R7901:2410089E03Rik UTSW 15 8269706 missense unknown
R7983:2410089E03Rik UTSW 15 8221815 missense probably benign 0.01
R8030:2410089E03Rik UTSW 15 8230303 missense probably damaging 1.00
R8088:2410089E03Rik UTSW 15 8186318 missense probably benign 0.00
R8231:2410089E03Rik UTSW 15 8219027 missense probably benign 0.16
R8443:2410089E03Rik UTSW 15 8201151 missense probably benign 0.03
R8480:2410089E03Rik UTSW 15 8187458 missense possibly damaging 0.63
R8693:2410089E03Rik UTSW 15 8229008 missense probably benign 0.15
R8785:2410089E03Rik UTSW 15 8174760 missense probably benign 0.39
R8791:2410089E03Rik UTSW 15 8187260 missense probably damaging 1.00
R8822:2410089E03Rik UTSW 15 8171778 missense probably damaging 1.00
R8831:2410089E03Rik UTSW 15 8182136 missense probably benign 0.09
R8932:2410089E03Rik UTSW 15 8194375 missense probably damaging 1.00
R8968:2410089E03Rik UTSW 15 8201281 missense possibly damaging 0.84
R8973:2410089E03Rik UTSW 15 8203793 missense probably damaging 1.00
R9036:2410089E03Rik UTSW 15 8223138 missense possibly damaging 0.63
R9134:2410089E03Rik UTSW 15 8199232 missense probably damaging 0.99
R9197:2410089E03Rik UTSW 15 8251052 missense unknown
R9259:2410089E03Rik UTSW 15 8203303 missense possibly damaging 0.82
R9269:2410089E03Rik UTSW 15 8219016 missense probably damaging 0.97
R9294:2410089E03Rik UTSW 15 8203327 missense probably benign 0.00
R9328:2410089E03Rik UTSW 15 8186208 missense probably damaging 1.00
R9563:2410089E03Rik UTSW 15 8187079 missense probably benign 0.20
R9680:2410089E03Rik UTSW 15 8202301 missense possibly damaging 0.68
R9721:2410089E03Rik UTSW 15 8225409 missense unknown
R9779:2410089E03Rik UTSW 15 8201302 missense possibly damaging 0.93
R9780:2410089E03Rik UTSW 15 8228639 missense probably benign 0.00
U24488:2410089E03Rik UTSW 15 8182210 missense probably damaging 1.00
X0023:2410089E03Rik UTSW 15 8247031 missense unknown
Z1177:2410089E03Rik UTSW 15 8174972 missense probably damaging 1.00
Z1177:2410089E03Rik UTSW 15 8209989 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCCCAGGCAGAATTGGATCC -3'
(R):5'- TGAGTGTACTGCTCACGCTG -3'

Sequencing Primer
(F):5'- AGGCAGAATTGGATCCCTTTC -3'
(R):5'- AGAACCTGTCCGCAGCAG -3'
Posted On 2015-10-08