Incidental Mutation 'R4659:Mx1'
ID352715
Institutional Source Beutler Lab
Gene Symbol Mx1
Ensembl Gene ENSMUSG00000000386
Gene NameMX dynamin-like GTPase 1
SynonymsMx-1, Mx, myxovirus (influenza) resistance 1 polypeptide
MMRRC Submission 041919-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4659 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location97447035-97462907 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 97455239 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109397 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023655] [ENSMUST00000023655] [ENSMUST00000113768] [ENSMUST00000113768] [ENSMUST00000135184] [ENSMUST00000142883] [ENSMUST00000155233] [ENSMUST00000232193] [ENSMUST00000232282]
Predicted Effect probably null
Transcript: ENSMUST00000023655
SMART Domains Protein: ENSMUSP00000023655
Gene: ENSMUSG00000000386

DomainStartEndE-ValueType
DYNc 12 255 3.52e-134 SMART
low complexity region 309 325 N/A INTRINSIC
Pfam:Dynamin_M 428 509 8.1e-12 PFAM
GED 534 625 5.58e-38 SMART
Predicted Effect probably null
Transcript: ENSMUST00000023655
SMART Domains Protein: ENSMUSP00000023655
Gene: ENSMUSG00000000386

DomainStartEndE-ValueType
DYNc 12 255 3.52e-134 SMART
low complexity region 309 325 N/A INTRINSIC
Pfam:Dynamin_M 428 509 8.1e-12 PFAM
GED 534 625 5.58e-38 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113768
SMART Domains Protein: ENSMUSP00000109397
Gene: ENSMUSG00000000386

DomainStartEndE-ValueType
DYNc 12 241 1.34e-98 SMART
low complexity region 279 289 N/A INTRINSIC
GED 304 395 5.58e-38 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113768
SMART Domains Protein: ENSMUSP00000109397
Gene: ENSMUSG00000000386

DomainStartEndE-ValueType
DYNc 12 241 1.34e-98 SMART
low complexity region 279 289 N/A INTRINSIC
GED 304 395 5.58e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135184
SMART Domains Protein: ENSMUSP00000138813
Gene: ENSMUSG00000000386

DomainStartEndE-ValueType
DYNc 2 111 2.62e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000142883
SMART Domains Protein: ENSMUSP00000114709
Gene: ENSMUSG00000000386

DomainStartEndE-ValueType
Pfam:Dynamin_N 39 65 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155233
SMART Domains Protein: ENSMUSP00000138532
Gene: ENSMUSG00000000386

DomainStartEndE-ValueType
DYNc 12 255 3.52e-134 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231461
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231995
Predicted Effect probably benign
Transcript: ENSMUST00000232193
Predicted Effect probably benign
Transcript: ENSMUST00000232282
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: This gene encodes a member of the Mx protein family of large GTPases, and functions in the innate immunity system. Interferon alpha/beta treatment or viral infection induces expression of this protein, which subsequently accumulates in the cytoplasm and inhibits viral replication. It has been shown to confer resistance to the influenza virus. This gene produces a functional protein in some feral mouse strains, whereas some inbred mouse strains including the strain of the reference genome, C57BL/6J, contain a deletion or a nonsense mutation that results in a non-functional gene product. [provided by RefSeq, Aug 2015]
PHENOTYPE: A2G, SL/NiA, T9 and CAST/Ei strains produce the MX1 protein (Mx1+ allele) conferring resistance to myxoviruses, whereas no protein is made by the Mx1- susceptible alleles of C57BL/6J and many other inbred strains with an exon 9-11 deletion; or CBA/J, CE/J, I/LnJ and PERA/Ei with a nonsense mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,216,276 probably benign Het
Abcc9 C A 6: 142,672,595 probably null Het
Ankrd22 C T 19: 34,125,568 V118I probably damaging Het
Aoc1 A T 6: 48,906,076 E295D probably benign Het
Arap2 T C 5: 62,654,126 N1114S possibly damaging Het
AU021092 C G 16: 5,212,147 A335P probably damaging Het
Carhsp1 T C 16: 8,664,265 T51A probably benign Het
Ccdc144b T C 3: 36,025,954 D218G possibly damaging Het
Cdc42bpb T C 12: 111,339,891 D152G probably damaging Het
Cep70 T A 9: 99,296,341 D497E possibly damaging Het
Chrm5 T C 2: 112,479,757 N338S probably benign Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clhc1 T A 11: 29,578,229 *586K probably null Het
Dopey1 T A 9: 86,502,032 probably benign Het
Dync1h1 T C 12: 110,628,767 F1371S possibly damaging Het
Eif6 A G 2: 155,826,181 I46T probably damaging Het
Esco2 G A 14: 65,826,586 T383M possibly damaging Het
Exoc8 T C 8: 124,897,532 D32G probably damaging Het
Fam149b G T 14: 20,367,873 S216I probably benign Het
Fam219a T C 4: 41,521,645 D87G probably null Het
Fbxw26 A T 9: 109,744,871 V71D probably damaging Het
Gabra4 T A 5: 71,641,144 K164M probably damaging Het
Gm8603 G A 17: 13,517,028 noncoding transcript Het
Gnmt A G 17: 46,725,966 F239S probably damaging Het
Gpsm1 G A 2: 26,319,831 probably benign Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Kcnj1 A T 9: 32,394,148 D2V probably benign Het
Limch1 C T 5: 67,027,557 R797C probably damaging Het
Lrrc9 T A 12: 72,470,264 F597I probably damaging Het
Lrriq3 T A 3: 155,129,453 I275N possibly damaging Het
Mcoln1 T A 8: 3,510,840 S387R probably damaging Het
Mgst3 T A 1: 167,377,279 Q58L probably damaging Het
Mical1 G A 10: 41,486,936 probably benign Het
Mmp3 C A 9: 7,453,673 D431E probably benign Het
Myo7a A G 7: 98,085,466 L607P probably damaging Het
Myt1l A G 12: 29,849,457 N153D probably damaging Het
Nfu1 A T 6: 87,019,426 T120S probably damaging Het
Nhlrc2 T C 19: 56,576,267 V341A possibly damaging Het
Notch1 T C 2: 26,470,889 E1148G probably damaging Het
Nqo1 C T 8: 107,391,044 probably null Het
Nwd1 T A 8: 72,695,321 D998E probably benign Het
Olfr1049 G A 2: 86,255,013 Q227* probably null Het
Oxct2a T C 4: 123,322,680 I303V probably benign Het
Parp10 A T 15: 76,242,985 D58E probably damaging Het
Pcdha6 T A 18: 36,969,239 V495E probably damaging Het
Pitrm1 T A 13: 6,553,182 S88R probably benign Het
Pxdn T C 12: 29,994,553 V510A probably benign Het
Ranbp17 T A 11: 33,266,288 D820V probably damaging Het
Sec24c G T 14: 20,683,144 G180C probably damaging Het
Serpina3n T C 12: 104,413,493 S382P probably benign Het
Sestd1 A T 2: 77,212,499 M237K probably null Het
Sf3a2 T C 10: 80,803,584 I136T probably damaging Het
Sh3tc2 A G 18: 61,974,509 Y197C probably benign Het
Speer4b T C 5: 27,497,895 K204E probably benign Het
Speer4f1 A C 5: 17,476,223 E33A possibly damaging Het
Sspo T A 6: 48,484,213 D3529E probably damaging Het
Stard13 T C 5: 151,062,788 D419G probably benign Het
Tg A G 15: 66,673,920 S164G possibly damaging Het
Thap12 A G 7: 98,710,091 probably benign Het
Thsd1 C A 8: 22,259,298 Y667* probably null Het
Tnks A C 8: 34,849,311 Y885D possibly damaging Het
Ttll3 A G 6: 113,414,141 I896V probably benign Het
Txnip T G 3: 96,559,427 F190C probably damaging Het
Urb1 T C 16: 90,776,129 D1005G probably damaging Het
Usp3 T C 9: 66,527,070 probably null Het
Usp54 G T 14: 20,564,992 Q794K probably damaging Het
Xrn2 A G 2: 147,061,474 Q798R probably benign Het
Zfp189 A G 4: 49,530,342 I482V probably benign Het
Zfp28 A G 7: 6,393,507 N314D probably benign Het
Zmym4 A G 4: 126,948,428 probably null Het
Other mutations in Mx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Mx1 APN 16 97457432 missense probably damaging 1.00
IGL01328:Mx1 APN 16 97455632 missense probably damaging 0.99
IGL03105:Mx1 APN 16 97456354 missense possibly damaging 0.94
PIT4585001:Mx1 UTSW 16 97456254 missense probably benign 0.07
R0003:Mx1 UTSW 16 97451588 intron probably benign
R1597:Mx1 UTSW 16 97455129 missense probably damaging 1.00
R1753:Mx1 UTSW 16 97454158 missense probably damaging 1.00
R1780:Mx1 UTSW 16 97451512 makesense probably null
R1826:Mx1 UTSW 16 97455637 missense possibly damaging 0.95
R1851:Mx1 UTSW 16 97448203 missense probably damaging 1.00
R1852:Mx1 UTSW 16 97448203 missense probably damaging 1.00
R2059:Mx1 UTSW 16 97454179 nonsense probably null
R2223:Mx1 UTSW 16 97455232 splice site probably benign
R3441:Mx1 UTSW 16 97456231 missense probably damaging 1.00
R3442:Mx1 UTSW 16 97456231 missense probably damaging 1.00
R3782:Mx1 UTSW 16 97451995 missense possibly damaging 0.75
R4460:Mx1 UTSW 16 97454081 missense probably damaging 0.99
R5116:Mx1 UTSW 16 97457479 missense possibly damaging 0.67
R5186:Mx1 UTSW 16 97455494 missense probably benign 0.09
R5215:Mx1 UTSW 16 97448360 missense possibly damaging 0.72
R5249:Mx1 UTSW 16 97457428 missense probably damaging 1.00
R5450:Mx1 UTSW 16 97454147 nonsense probably null
R5806:Mx1 UTSW 16 97454151 missense possibly damaging 0.81
R5894:Mx1 UTSW 16 97454206 missense probably damaging 1.00
R5916:Mx1 UTSW 16 97451733 missense probably benign 0.00
R5981:Mx1 UTSW 16 97454205 missense probably damaging 1.00
R7111:Mx1 UTSW 16 97455176 missense probably damaging 0.99
R7207:Mx1 UTSW 16 97452198 missense probably benign
R7238:Mx1 UTSW 16 97448296 missense unknown
R7318:Mx1 UTSW 16 97452086 missense probably benign 0.06
R7856:Mx1 UTSW 16 97455535 missense probably damaging 1.00
R7939:Mx1 UTSW 16 97455535 missense probably damaging 1.00
R8012:Mx1 UTSW 16 97457372 missense probably damaging 1.00
X0028:Mx1 UTSW 16 97450421 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACTTGTATCACACACCACTGTC -3'
(R):5'- CAGGGATGCTGGAGTATTTCC -3'

Sequencing Primer
(F):5'- TGTATCACACACCACTGTCATCTAC -3'
(R):5'- ATTTCCAGGGCTATGTCTAAGAGAG -3'
Posted On2015-10-08