Incidental Mutation 'R0270:Cfap43'
ID35276
Institutional Source Beutler Lab
Gene Symbol Cfap43
Ensembl Gene ENSMUSG00000044948
Gene Namecilia and flagella associated protein 43
Synonyms4930463G05Rik, D19Ertd652e, 4632415N18Rik, 4930428C11Rik, Wdr96
MMRRC Submission 038496-MU
Accession Numbers

Genbank: NM_027559

Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R0270 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location47737561-47919299 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 47797203 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160247]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000026048
Predicted Effect probably benign
Transcript: ENSMUST00000160247
SMART Domains Protein: ENSMUSP00000125007
Gene: ENSMUSG00000044948

DomainStartEndE-ValueType
low complexity region 12 36 N/A INTRINSIC
Blast:WD40 70 111 6e-7 BLAST
Blast:WD40 115 156 1e-5 BLAST
Blast:WD40 162 197 8e-10 BLAST
WD40 349 388 1.07e0 SMART
Blast:WD40 392 432 3e-13 BLAST
WD40 435 473 3.96e1 SMART
WD40 479 518 3.82e1 SMART
Blast:WD40 638 683 8e-17 BLAST
Blast:WD40 689 728 1e-17 BLAST
low complexity region 766 781 N/A INTRINSIC
coiled coil region 855 886 N/A INTRINSIC
coiled coil region 925 961 N/A INTRINSIC
low complexity region 971 981 N/A INTRINSIC
coiled coil region 1170 1224 N/A INTRINSIC
low complexity region 1248 1259 N/A INTRINSIC
low complexity region 1268 1279 N/A INTRINSIC
low complexity region 1524 1529 N/A INTRINSIC
coiled coil region 1652 1671 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160970
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.7%
  • 10x: 96.0%
  • 20x: 93.2%
Validation Efficiency 99% (113/114)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cilia- and flagella-associated protein family. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete male sterility, asthenozoospermia, and teratozoospermia characterized by short, thick, and coiled flagella and sperm axonemal defects. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock
Total: 109 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3110009E18Rik T A 1: 120,166,176 probably benign Het
4922502D21Rik A T 6: 129,325,608 L152* probably null Het
Abcf3 T A 16: 20,560,168 probably null Het
Acadm C T 3: 153,936,324 M190I possibly damaging Het
Adamtsl3 G A 7: 82,556,824 R739Q probably damaging Het
Ank1 T A 8: 23,088,925 probably benign Het
Ap3b1 T A 13: 94,404,118 probably benign Het
Arhgdib A G 6: 136,926,734 V31A probably damaging Het
Arid4a A G 12: 71,072,632 R342G probably damaging Het
Asic3 C T 5: 24,417,702 L517F probably benign Het
Atxn7l1 C T 12: 33,342,151 P242L possibly damaging Het
AY761185 T A 8: 20,944,600 E37D possibly damaging Het
Babam1 T A 8: 71,398,406 D104E probably damaging Het
Batf A T 12: 85,708,672 T100S probably benign Het
Blcap A T 2: 157,557,977 Y59* probably null Het
Cacnb3 G A 15: 98,642,559 A350T probably damaging Het
Cdk15 T A 1: 59,310,806 V319D probably damaging Het
Cenpf T C 1: 189,650,714 H2661R probably benign Het
Cenpq T C 17: 40,930,050 E106G probably damaging Het
Cfb G A 17: 34,860,386 S778L possibly damaging Het
Clspn T A 4: 126,573,236 N631K probably damaging Het
Cntn2 T A 1: 132,521,724 T660S probably damaging Het
Cntrob T A 11: 69,311,341 H475L possibly damaging Het
Ddx46 T C 13: 55,674,104 I863T probably benign Het
Dnah11 G A 12: 118,041,013 T2191I probably damaging Het
Dock9 T C 14: 121,575,999 T1703A probably benign Het
Fam13c C T 10: 70,544,513 P424S probably benign Het
Fan1 T C 7: 64,348,871 N968D probably benign Het
Fbxl20 A T 11: 98,098,503 probably benign Het
Fkbp1b A T 12: 4,838,229 probably benign Het
G930045G22Rik T A 6: 50,847,059 noncoding transcript Het
Gm28042 C A 2: 120,041,592 R1008S probably benign Het
Gm6614 T A 6: 141,972,411 I580F possibly damaging Het
Gm8298 T A 3: 59,877,019 N304K probably benign Het
Gon4l G A 3: 88,858,400 S376N probably damaging Het
Gstt3 C A 10: 75,780,915 R15L probably damaging Het
Gtdc1 A T 2: 44,752,174 S73T possibly damaging Het
H2afy G A 13: 56,096,114 probably benign Het
Hhatl A G 9: 121,784,720 S419P probably benign Het
Hirip3 T G 7: 126,863,191 S46R probably damaging Het
Hsf2 A G 10: 57,502,639 T204A probably benign Het
Impg2 G A 16: 56,269,015 E1108K possibly damaging Het
Itgb2l G T 16: 96,422,930 probably benign Het
Itih5 A T 2: 10,251,264 N847I probably benign Het
Kif1a T C 1: 93,054,442 probably benign Het
Klhl1 T A 14: 96,518,344 probably benign Het
Ktn1 T A 14: 47,714,662 D963E probably benign Het
Lclat1 T A 17: 73,240,027 V313E probably benign Het
Lrrn4 T C 2: 132,870,719 S395G probably benign Het
Mbtps1 G A 8: 119,538,117 probably benign Het
Me1 A G 9: 86,596,204 probably benign Het
Mov10 C A 3: 104,795,405 C948F probably benign Het
Mterf1a G A 5: 3,890,990 Q293* probably null Het
Nfkb2 A T 19: 46,311,626 M838L possibly damaging Het
Nhlrc2 T A 19: 56,551,870 L97Q probably damaging Het
Nr6a1 A T 2: 38,739,020 Y331N possibly damaging Het
Nup214 C T 2: 32,034,814 A1785V probably damaging Het
Ogg1 C T 6: 113,329,256 T138I probably benign Het
Olfr1461 A G 19: 13,165,887 Y291C probably damaging Het
Olfr1489 A G 19: 13,633,684 Y191C probably damaging Het
Olfr202 A G 16: 59,283,753 V248A probably damaging Het
Olfr829 T A 9: 18,856,831 Y60N probably damaging Het
Plod2 G T 9: 92,584,521 R178L probably benign Het
Polr3b T A 10: 84,718,475 L1017Q probably benign Het
Postn C A 3: 54,384,550 T724N probably damaging Het
Ppm1l T G 3: 69,317,976 probably benign Het
Prpf8 T G 11: 75,505,249 L1983R probably damaging Het
Psma7 A G 2: 180,039,400 V59A probably benign Het
Qser1 T A 2: 104,788,961 Y502F probably benign Het
Rad50 T C 11: 53,668,025 D1129G probably damaging Het
Rasal1 C A 5: 120,674,729 P606Q probably damaging Het
Rgs6 A G 12: 83,133,689 Y438C probably damaging Het
Rnf180 A G 13: 105,252,266 C73R probably benign Het
Rnf216 T A 5: 143,080,241 I474F possibly damaging Het
Sdha A T 13: 74,332,247 L371Q probably damaging Het
Sdk1 T G 5: 142,084,566 L1162R possibly damaging Het
Sh3rf2 T C 18: 42,104,081 I223T probably damaging Het
Sirpb1a A G 3: 15,410,527 V316A probably damaging Het
Slc12a4 A T 8: 105,945,389 I897N probably benign Het
Slc35d1 A T 4: 103,190,838 V243E probably damaging Het
Slc4a11 T A 2: 130,690,932 K200N possibly damaging Het
Slc9a8 T A 2: 167,451,296 M188K probably damaging Het
Snrnp200 T C 2: 127,232,982 S1492P probably damaging Het
Sphk2 T C 7: 45,710,725 *618W probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tdpoz3 A G 3: 93,826,924 N302S probably benign Het
Tdrd6 T C 17: 43,624,308 M1950V probably benign Het
Tmem39a A G 16: 38,564,313 probably benign Het
Trip4 A T 9: 65,858,358 I353K probably damaging Het
Trip6 A T 5: 137,312,841 F204L probably benign Het
Trpm4 T A 7: 45,319,253 I419F possibly damaging Het
Ttn C A 2: 76,944,796 E1967D probably damaging Het
Uba2 C T 7: 34,150,856 V391M possibly damaging Het
Ubr4 T G 4: 139,479,435 probably benign Het
Upf1 G A 8: 70,335,645 probably benign Het
Vmn1r228 A C 17: 20,776,596 V220G possibly damaging Het
Vmn2r79 A G 7: 87,003,386 M429V probably benign Het
Vps36 C T 8: 22,210,456 T210I possibly damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Ybx1 C T 4: 119,281,591 G126D probably benign Het
Yipf5 C A 18: 40,206,407 probably benign Het
Zdhhc5 A C 2: 84,690,115 S573A probably benign Het
Zfp457 A T 13: 67,293,927 C99S probably damaging Het
Zfp52 T A 17: 21,561,302 C471S probably damaging Het
Zfp558 C T 9: 18,467,956 V71I probably damaging Het
Zfp651 A G 9: 121,767,575 T666A probably benign Het
Zfp655 A G 5: 145,244,457 Y375C probably damaging Het
Zfp882 A T 8: 71,914,615 T429S probably benign Het
Zmym2 T C 14: 56,949,684 probably null Het
Other mutations in Cfap43
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Cfap43 APN 19 47830475 missense probably benign 0.08
IGL00325:Cfap43 APN 19 47823188 splice site probably benign
IGL00918:Cfap43 APN 19 47896661 missense probably damaging 1.00
IGL01402:Cfap43 APN 19 47795666 missense probably benign 0.25
IGL01404:Cfap43 APN 19 47795666 missense probably benign 0.25
IGL01656:Cfap43 APN 19 47751900 missense possibly damaging 0.95
IGL01738:Cfap43 APN 19 47797185 missense probably damaging 0.97
IGL02168:Cfap43 APN 19 47751923 splice site probably benign
IGL02225:Cfap43 APN 19 47812177 missense probably benign 0.00
IGL02308:Cfap43 APN 19 47748024 missense probably benign
IGL02354:Cfap43 APN 19 47897413 nonsense probably null
IGL02361:Cfap43 APN 19 47897413 nonsense probably null
IGL03283:Cfap43 APN 19 47791412 splice site probably benign
3-1:Cfap43 UTSW 19 47751855 missense probably benign 0.02
IGL03046:Cfap43 UTSW 19 47815863 missense probably damaging 1.00
PIT4495001:Cfap43 UTSW 19 47897302 missense probably damaging 1.00
R0421:Cfap43 UTSW 19 47835575 missense probably benign 0.00
R0433:Cfap43 UTSW 19 47825771 missense probably benign 0.44
R0576:Cfap43 UTSW 19 47797140 missense probably benign 0.00
R0646:Cfap43 UTSW 19 47763676 missense probably benign 0.25
R0740:Cfap43 UTSW 19 47835804 missense possibly damaging 0.95
R0836:Cfap43 UTSW 19 47815846 missense probably benign 0.02
R0899:Cfap43 UTSW 19 47747994 missense possibly damaging 0.93
R1171:Cfap43 UTSW 19 47835711 missense probably benign 0.03
R1271:Cfap43 UTSW 19 47739744 missense probably benign 0.22
R1271:Cfap43 UTSW 19 47747948 missense probably damaging 0.98
R1371:Cfap43 UTSW 19 47835606 missense possibly damaging 0.95
R1469:Cfap43 UTSW 19 47896875 missense probably damaging 1.00
R1541:Cfap43 UTSW 19 47763852 splice site probably null
R1625:Cfap43 UTSW 19 47751088 missense probably damaging 1.00
R1679:Cfap43 UTSW 19 47773114 missense probably benign 0.00
R1690:Cfap43 UTSW 19 47751066 critical splice donor site probably null
R1820:Cfap43 UTSW 19 47897216 missense probably damaging 0.99
R1891:Cfap43 UTSW 19 47813941 missense probably damaging 0.97
R1956:Cfap43 UTSW 19 47897210 missense probably benign 0.19
R1958:Cfap43 UTSW 19 47897210 missense probably benign 0.19
R2110:Cfap43 UTSW 19 47835758 missense probably damaging 1.00
R2118:Cfap43 UTSW 19 47770438 missense probably damaging 1.00
R2290:Cfap43 UTSW 19 47773135 missense probably damaging 0.99
R3691:Cfap43 UTSW 19 47897073 missense probably benign 0.01
R3765:Cfap43 UTSW 19 47835575 missense probably benign 0.01
R3917:Cfap43 UTSW 19 47897750 missense probably benign 0.00
R3924:Cfap43 UTSW 19 47797116 missense probably benign 0.00
R3925:Cfap43 UTSW 19 47797116 missense probably benign 0.00
R3947:Cfap43 UTSW 19 47765979 missense probably benign 0.28
R4256:Cfap43 UTSW 19 47782405 missense probably benign 0.06
R4385:Cfap43 UTSW 19 47797129 missense probably benign 0.28
R4395:Cfap43 UTSW 19 47751913 missense probably benign 0.00
R4405:Cfap43 UTSW 19 47739797 missense possibly damaging 0.57
R4541:Cfap43 UTSW 19 47748015 missense probably benign 0.02
R4583:Cfap43 UTSW 19 47837216 missense probably null 0.99
R4690:Cfap43 UTSW 19 47747859 missense probably benign 0.45
R4852:Cfap43 UTSW 19 47897111 missense possibly damaging 0.87
R5185:Cfap43 UTSW 19 47780394 missense probably benign 0.00
R5192:Cfap43 UTSW 19 47825925 missense probably damaging 1.00
R5196:Cfap43 UTSW 19 47825925 missense probably damaging 1.00
R5197:Cfap43 UTSW 19 47897372 missense probably damaging 1.00
R5205:Cfap43 UTSW 19 47897548 missense possibly damaging 0.76
R5425:Cfap43 UTSW 19 47896932 missense possibly damaging 0.94
R5516:Cfap43 UTSW 19 47738209 intron probably null
R5644:Cfap43 UTSW 19 47795675 missense possibly damaging 0.66
R5844:Cfap43 UTSW 19 47795696 missense probably benign
R5901:Cfap43 UTSW 19 47897099 missense probably damaging 0.97
R5910:Cfap43 UTSW 19 47780271 missense possibly damaging 0.63
R5920:Cfap43 UTSW 19 47760896 missense possibly damaging 0.88
R5963:Cfap43 UTSW 19 47745574 missense probably benign 0.42
R6817:Cfap43 UTSW 19 47756085 missense possibly damaging 0.88
R6974:Cfap43 UTSW 19 47785278 critical splice donor site probably null
R7219:Cfap43 UTSW 19 47791473 missense probably benign 0.02
R7270:Cfap43 UTSW 19 47739785 missense possibly damaging 0.86
R7733:Cfap43 UTSW 19 47897993 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- AGAGAAGCCCCTGTCCCATTATTCC -3'
(R):5'- AGGCACCCAGGTATGATAGTCTGTG -3'

Sequencing Primer
(F):5'- ACTCCCTGGAGAGATACTCTTTGAG -3'
(R):5'- ATGATAGTCTGTGCCTGTAACC -3'
Posted On2013-05-09