Incidental Mutation 'R0271:Gtf3c3'
ID35278
Institutional Source Beutler Lab
Gene Symbol Gtf3c3
Ensembl Gene ENSMUSG00000041303
Gene Namegeneral transcription factor IIIC, polypeptide 3
Synonyms
MMRRC Submission 038497-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R0271 (G1)
Quality Score224
Status Validated
Chromosome1
Chromosomal Location54396004-54438971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 54428812 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 222 (M222K)
Ref Sequence ENSEMBL: ENSMUSP00000039420 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041638]
Predicted Effect possibly damaging
Transcript: ENSMUST00000041638
AA Change: M222K

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000039420
Gene: ENSMUSG00000041303
AA Change: M222K

DomainStartEndE-ValueType
low complexity region 18 34 N/A INTRINSIC
low complexity region 92 108 N/A INTRINSIC
TPR 145 178 9.24e1 SMART
TPR 179 212 2.36e1 SMART
TPR 213 246 4.58e-4 SMART
TPR 247 280 6.4e1 SMART
Blast:TPR 286 319 6e-9 BLAST
low complexity region 353 365 N/A INTRINSIC
TPR 452 485 1.87e1 SMART
low complexity region 549 560 N/A INTRINSIC
TPR 807 840 3.27e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189906
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190419
Meta Mutation Damage Score 0.7270 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is part of the TFIIIC2 complex, which binds to the promoters of small nuclear and cytoplasmic RNA genes in order to recruit RNA polymerase III. The TFIIIC2 complex is composed of six subunits. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,686,329 probably benign Het
4930544D05Rik A G 11: 70,616,648 Q173R possibly damaging Het
Ampd2 C T 3: 108,086,716 probably benign Het
Ankrd17 T C 5: 90,254,799 S1467G possibly damaging Het
Arhgap31 T G 16: 38,602,510 S1065R possibly damaging Het
Arhgef19 G T 4: 141,250,607 M542I probably benign Het
C7 T C 15: 5,015,380 D392G possibly damaging Het
Ccdc138 G A 10: 58,575,823 C671Y probably damaging Het
Cdh8 A G 8: 99,111,715 S498P possibly damaging Het
Cpb2 T A 14: 75,257,709 probably null Het
Cwc22 A C 2: 77,920,858 N389K probably benign Het
Dgkb T A 12: 38,228,026 L550Q probably damaging Het
Dip2c A G 13: 9,615,775 R950G probably damaging Het
Eml6 A G 11: 29,848,949 V437A possibly damaging Het
Fanca T C 8: 123,272,441 probably benign Het
Fgd2 C G 17: 29,367,008 L189V possibly damaging Het
Foxred2 A C 15: 77,943,390 S590A possibly damaging Het
Gm1110 A G 9: 26,920,666 F63S probably damaging Het
Gm14496 A T 2: 181,995,954 M274L probably benign Het
Gm7008 T A 12: 40,223,560 probably benign Het
Gm9922 T A 14: 101,729,553 probably benign Het
Hspa1b A G 17: 34,958,832 V59A probably benign Het
Impg1 T C 9: 80,386,879 probably benign Het
Lpcat4 T A 2: 112,243,245 probably null Het
Mipol1 T C 12: 57,460,954 probably benign Het
Mrpl37 C A 4: 107,066,461 R112L possibly damaging Het
Myo18b T C 5: 112,809,685 N1471D possibly damaging Het
Nes G A 3: 87,978,642 E1359K possibly damaging Het
Nipbl A T 15: 8,361,737 V251E possibly damaging Het
Nlrp1b T C 11: 71,161,765 I946V possibly damaging Het
Obscn T G 11: 59,056,742 probably benign Het
Olfr1024 A T 2: 85,904,289 M255K possibly damaging Het
Olfr1239 T A 2: 89,418,158 Y85F probably benign Het
Olfr1491 A T 19: 13,705,135 T103S probably benign Het
Olfr635 T A 7: 103,979,630 I146K possibly damaging Het
Pck2 T C 14: 55,544,584 probably null Het
Pcsk9 A G 4: 106,449,049 probably benign Het
Phyhd1 A T 2: 30,269,822 Q56L probably benign Het
Plxnc1 C T 10: 94,837,918 G1001S probably null Het
Prss52 T C 14: 64,113,678 V304A probably benign Het
Prss55 C T 14: 64,075,607 G276D probably benign Het
Pzp A T 6: 128,519,514 Y252N probably damaging Het
Rad1 T C 15: 10,490,457 probably null Het
Ripply3 A T 16: 94,335,757 E92D possibly damaging Het
Rpp30 T A 19: 36,104,403 D255E probably benign Het
Rsad1 T C 11: 94,548,464 probably benign Het
Serpini2 A G 3: 75,246,578 M358T probably damaging Het
Slc35a1 T A 4: 34,664,125 E331V probably benign Het
Slc38a7 A G 8: 95,845,878 F179L probably damaging Het
Stmn4 C T 14: 66,356,283 Q42* probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tab2 G A 10: 7,919,158 A520V probably benign Het
Tcp10a A G 17: 7,331,156 I162M probably benign Het
Tmprss13 A G 9: 45,333,688 probably benign Het
Tnfrsf14 A G 4: 154,926,597 probably null Het
Tpx2 A G 2: 152,867,367 probably benign Het
Vmn2r105 T A 17: 20,234,703 N57I probably damaging Het
Wars C T 12: 108,875,193 V220I probably benign Het
Washc1 T A 17: 66,116,719 D212E possibly damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Wdr43 A G 17: 71,626,825 D139G probably benign Het
Zfp235 A T 7: 24,137,131 H34L possibly damaging Het
Zkscan16 G A 4: 58,952,391 V230I probably benign Het
Other mutations in Gtf3c3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00428:Gtf3c3 APN 1 54415955 missense probably damaging 0.99
IGL00435:Gtf3c3 APN 1 54427535 missense possibly damaging 0.73
IGL01128:Gtf3c3 APN 1 54428876 missense possibly damaging 0.91
R0243:Gtf3c3 UTSW 1 54403536 missense possibly damaging 0.60
R0571:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R0965:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R0968:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1069:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1070:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1111:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1112:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1113:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1114:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1115:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1117:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1118:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1119:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1228:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1230:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1231:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1313:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1313:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1382:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1394:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1395:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1397:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1414:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1430:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1432:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1473:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1497:Gtf3c3 UTSW 1 54437939 missense probably benign
R1556:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1563:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1638:Gtf3c3 UTSW 1 54405119 missense probably damaging 1.00
R1695:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1716:Gtf3c3 UTSW 1 54399260 missense probably damaging 1.00
R1745:Gtf3c3 UTSW 1 54434212 missense probably damaging 1.00
R1767:Gtf3c3 UTSW 1 54417778 missense probably damaging 1.00
R1799:Gtf3c3 UTSW 1 54420424 missense possibly damaging 0.82
R1861:Gtf3c3 UTSW 1 54438838 missense possibly damaging 0.87
R1940:Gtf3c3 UTSW 1 54428958 splice site probably benign
R3804:Gtf3c3 UTSW 1 54424007 critical splice donor site probably null
R4496:Gtf3c3 UTSW 1 54424132 missense probably benign 0.03
R4621:Gtf3c3 UTSW 1 54419416 missense probably damaging 1.00
R5131:Gtf3c3 UTSW 1 54419498 synonymous probably null
R5320:Gtf3c3 UTSW 1 54405873 missense probably damaging 1.00
R5605:Gtf3c3 UTSW 1 54415926 missense probably benign 0.06
R5854:Gtf3c3 UTSW 1 54419437 missense probably benign 0.01
R6050:Gtf3c3 UTSW 1 54406070 missense probably benign 0.00
R6441:Gtf3c3 UTSW 1 54406038 missense probably benign 0.03
R6892:Gtf3c3 UTSW 1 54415941 missense probably benign 0.00
R7114:Gtf3c3 UTSW 1 54423507 missense probably benign
R7299:Gtf3c3 UTSW 1 54417708 missense probably benign 0.01
R7441:Gtf3c3 UTSW 1 54420448 missense probably benign 0.00
R7586:Gtf3c3 UTSW 1 54403593 missense probably damaging 1.00
R7615:Gtf3c3 UTSW 1 54423572 missense possibly damaging 0.49
R7739:Gtf3c3 UTSW 1 54405039 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- GAGAAACAAACACCTGGAGTAACGACAT -3'
(R):5'- TTCAGAAGGTTTGGTAGAAAGCAGGG -3'

Sequencing Primer
(F):5'- TGGAGTAACGACATAACCCAAAAG -3'
(R):5'- ggtagcaagagtccatccc -3'
Posted On2013-05-09