Incidental Mutation 'R4660:Golgb1'
ID 352802
Institutional Source Beutler Lab
Gene Symbol Golgb1
Ensembl Gene ENSMUSG00000034243
Gene Name golgin B1
Synonyms C130074L01Rik, Gm6840, F730017E11Rik, Giantin, 6330407A06Rik
MMRRC Submission 041920-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.918) question?
Stock # R4660 (G1)
Quality Score 211
Status Validated
Chromosome 16
Chromosomal Location 36695502-36753447 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 36707980 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 107 (I107N)
Ref Sequence ENSEMBL: ENSMUSP00000110460 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039855] [ENSMUST00000114812] [ENSMUST00000134616] [ENSMUST00000135406]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000039855
AA Change: I107N

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000045239
Gene: ENSMUSG00000034243
AA Change: I107N

DomainStartEndE-ValueType
internal_repeat_2 24 61 7.47e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
coiled coil region 130 219 N/A INTRINSIC
low complexity region 491 512 N/A INTRINSIC
internal_repeat_3 519 558 7.47e-6 PROSPERO
coiled coil region 563 594 N/A INTRINSIC
internal_repeat_4 627 661 3.38e-5 PROSPERO
coiled coil region 679 1121 N/A INTRINSIC
coiled coil region 1153 1240 N/A INTRINSIC
internal_repeat_4 1253 1288 3.38e-5 PROSPERO
low complexity region 1300 1314 N/A INTRINSIC
internal_repeat_1 1321 1352 3.51e-6 PROSPERO
low complexity region 1357 1369 N/A INTRINSIC
coiled coil region 1402 1755 N/A INTRINSIC
internal_repeat_2 1760 1798 7.47e-6 PROSPERO
internal_repeat_3 1761 1804 7.47e-6 PROSPERO
coiled coil region 1818 2034 N/A INTRINSIC
low complexity region 2291 2306 N/A INTRINSIC
internal_repeat_1 2351 2382 3.51e-6 PROSPERO
low complexity region 2400 2418 N/A INTRINSIC
low complexity region 2538 2549 N/A INTRINSIC
coiled coil region 2775 2827 N/A INTRINSIC
coiled coil region 2854 2943 N/A INTRINSIC
low complexity region 2964 2976 N/A INTRINSIC
coiled coil region 3007 3057 N/A INTRINSIC
coiled coil region 3117 3163 N/A INTRINSIC
transmembrane domain 3215 3237 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114812
AA Change: I107N

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000110460
Gene: ENSMUSG00000034243
AA Change: I107N

DomainStartEndE-ValueType
internal_repeat_2 24 61 6.71e-6 PROSPERO
low complexity region 87 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
low complexity region 143 154 N/A INTRINSIC
low complexity region 200 219 N/A INTRINSIC
low complexity region 450 471 N/A INTRINSIC
internal_repeat_3 478 517 6.71e-6 PROSPERO
coiled coil region 522 553 N/A INTRINSIC
internal_repeat_4 586 620 3.05e-5 PROSPERO
coiled coil region 638 1080 N/A INTRINSIC
coiled coil region 1112 1199 N/A INTRINSIC
internal_repeat_4 1212 1247 3.05e-5 PROSPERO
low complexity region 1259 1273 N/A INTRINSIC
internal_repeat_1 1280 1311 3.14e-6 PROSPERO
low complexity region 1316 1328 N/A INTRINSIC
coiled coil region 1361 1714 N/A INTRINSIC
internal_repeat_2 1719 1757 6.71e-6 PROSPERO
internal_repeat_3 1720 1763 6.71e-6 PROSPERO
coiled coil region 1777 1993 N/A INTRINSIC
low complexity region 2250 2265 N/A INTRINSIC
internal_repeat_1 2310 2341 3.14e-6 PROSPERO
low complexity region 2359 2377 N/A INTRINSIC
low complexity region 2497 2508 N/A INTRINSIC
coiled coil region 2734 2786 N/A INTRINSIC
coiled coil region 2813 2902 N/A INTRINSIC
low complexity region 2923 2935 N/A INTRINSIC
coiled coil region 2966 3016 N/A INTRINSIC
coiled coil region 3076 3122 N/A INTRINSIC
transmembrane domain 3174 3196 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134616
AA Change: I107N

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000116503
Gene: ENSMUSG00000034243
AA Change: I107N

DomainStartEndE-ValueType
coiled coil region 42 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000135406
AA Change: I107N

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115848
Gene: ENSMUSG00000034243
AA Change: I107N

DomainStartEndE-ValueType
coiled coil region 42 107 N/A INTRINSIC
low complexity region 120 134 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153572
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (102/106)
MGI Phenotype PHENOTYPE: Homozygous knockout affects glycosylation of glycoproteins in the extra-cellular matrix of the palatal shelves, resulting in their failure to elevate and fuse, leading to cleft palate. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted, other(2) Gene trapped(5)

Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d T C 2: 131,403,062 (GRCm39) T343A probably damaging Het
Angptl4 A T 17: 33,996,249 (GRCm39) probably benign Het
Antxr2 A T 5: 98,151,913 (GRCm39) probably null Het
Ap1b1 T A 11: 4,966,760 (GRCm39) V145E probably damaging Het
Asns G T 6: 7,678,012 (GRCm39) N355K probably benign Het
Asxl3 A G 18: 22,649,534 (GRCm39) T508A probably benign Het
B4galt7 T A 13: 55,752,111 (GRCm39) V54D possibly damaging Het
Bach2 C T 4: 32,562,777 (GRCm39) P415S probably benign Het
Bbs9 G A 9: 22,490,063 (GRCm39) R278Q probably benign Het
Blzf1 C T 1: 164,134,062 (GRCm39) probably benign Het
Btd A T 14: 31,389,760 (GRCm39) T494S probably benign Het
Casp9 C T 4: 141,540,934 (GRCm39) T434I probably benign Het
Cavin2 T C 1: 51,340,510 (GRCm39) S396P probably benign Het
Ccnk C T 12: 108,168,575 (GRCm39) probably benign Het
Cldn8 G A 16: 88,359,296 (GRCm39) H210Y probably benign Het
Clip1 G A 5: 123,717,437 (GRCm39) T1284I probably damaging Het
Coch T C 12: 51,642,268 (GRCm39) V80A probably benign Het
Cttnbp2 A G 6: 18,406,536 (GRCm39) S1052P probably benign Het
Cyp2j7 C T 4: 96,083,579 (GRCm39) R457K probably benign Het
Dalrd3 T C 9: 108,447,568 (GRCm39) S129P probably benign Het
Ddx10 A G 9: 53,147,698 (GRCm39) probably null Het
Dnah7b A T 1: 46,328,696 (GRCm39) T3143S probably damaging Het
Dynlt1b A G 17: 6,699,279 (GRCm39) T10A probably benign Het
Eif2s2 G A 2: 154,730,189 (GRCm39) T36I probably benign Het
Fam118b A T 9: 35,146,551 (GRCm39) H105Q possibly damaging Het
Galntl5 T A 5: 25,408,377 (GRCm39) I250N probably damaging Het
Gm11544 C T 11: 94,736,306 (GRCm39) noncoding transcript Het
Gm5709 C T 3: 59,526,124 (GRCm39) noncoding transcript Het
Gpld1 T C 13: 25,166,586 (GRCm39) probably null Het
Grik1 T A 16: 87,720,019 (GRCm39) T768S probably damaging Het
H2-T23 T G 17: 36,341,108 (GRCm39) Q349P probably damaging Het
Ing3 A T 6: 21,973,710 (GRCm39) probably benign Het
Iqgap3 T G 3: 88,027,483 (GRCm39) L702R probably damaging Het
Itga8 A G 2: 12,270,069 (GRCm39) V139A probably damaging Het
Jam2 G A 16: 84,609,840 (GRCm39) V151M probably damaging Het
Kbtbd12 T C 6: 88,594,772 (GRCm39) I353V probably benign Het
Kif27 T C 13: 58,471,730 (GRCm39) E786G probably damaging Het
Lingo4 T A 3: 94,310,672 (GRCm39) S537T probably benign Het
Lipo3 C T 19: 33,598,360 (GRCm39) probably benign Het
Lrrc3 G T 10: 77,729,866 (GRCm39) probably benign Het
Ltbp3 T A 19: 5,798,814 (GRCm39) probably null Het
Lyg1 T A 1: 37,985,942 (GRCm39) probably benign Het
Mcm9 T C 10: 53,424,623 (GRCm39) I656V probably benign Het
Mfsd8 T A 3: 40,776,372 (GRCm39) I427F probably benign Het
Mga T A 2: 119,769,104 (GRCm39) probably benign Het
Miga1 A G 3: 151,993,155 (GRCm39) L422P probably damaging Het
Msantd3 A G 4: 48,552,536 (GRCm39) I42V probably benign Het
Mybbp1a T C 11: 72,336,538 (GRCm39) V510A probably benign Het
Nccrp1 G T 7: 28,245,760 (GRCm39) P135T probably damaging Het
Neb T A 2: 52,145,600 (GRCm39) M2975L possibly damaging Het
Nfxl1 A T 5: 72,710,011 (GRCm39) I171N probably damaging Het
Odad2 A G 18: 7,211,609 (GRCm39) V755A possibly damaging Het
Or10q3 T C 19: 11,848,412 (GRCm39) H56R possibly damaging Het
Or12j5 A T 7: 140,083,933 (GRCm39) F146L probably benign Het
Or13a19 T C 7: 139,903,325 (GRCm39) F238L possibly damaging Het
Otop1 T G 5: 38,457,368 (GRCm39) S376A possibly damaging Het
Pdgfra T C 5: 75,322,932 (GRCm39) V10A possibly damaging Het
Pgs1 T C 11: 117,910,503 (GRCm39) V538A probably damaging Het
Ppa2 A T 3: 133,032,445 (GRCm39) T97S probably damaging Het
Pramel22 T A 4: 143,380,847 (GRCm39) Y392F probably benign Het
Pramel26 A G 4: 143,538,435 (GRCm39) S179P probably benign Het
Prdm10 G A 9: 31,238,624 (GRCm39) C172Y probably damaging Het
Prrc2c G A 1: 162,508,464 (GRCm39) P1091L probably damaging Het
Pthlh G A 6: 147,158,796 (GRCm39) R55C probably damaging Het
Ptpn9 A T 9: 56,943,782 (GRCm39) T105S probably benign Het
Rundc1 T A 11: 101,324,830 (GRCm39) V512E possibly damaging Het
Scrib G A 15: 75,937,185 (GRCm39) S307L probably damaging Het
Sec23ip A G 7: 128,352,010 (GRCm39) S26G probably null Het
Sec61a2 A G 2: 5,878,504 (GRCm39) probably benign Het
Sema3c T C 5: 17,877,511 (GRCm39) V206A probably damaging Het
Sgk2 C T 2: 162,839,763 (GRCm39) H124Y possibly damaging Het
Slc26a6 C T 9: 108,738,540 (GRCm39) T592I probably damaging Het
Slc5a11 T C 7: 122,864,486 (GRCm39) Y361H probably damaging Het
Smc6 T C 12: 11,324,008 (GRCm39) V51A probably damaging Het
Stab1 A T 14: 30,876,872 (GRCm39) N817K possibly damaging Het
Swt1 A T 1: 151,283,348 (GRCm39) D336E probably benign Het
Taf13 T A 3: 108,480,293 (GRCm39) probably benign Het
Tmub2 T C 11: 102,175,845 (GRCm39) probably benign Het
Tnf A G 17: 35,419,156 (GRCm39) S209P probably benign Het
Try10 A G 6: 41,334,761 (GRCm39) Y229C probably damaging Het
Ttbk1 G T 17: 46,788,714 (GRCm39) Y183* probably null Het
Ttc17 A T 2: 94,194,774 (GRCm39) I533N possibly damaging Het
Tubb6 C T 18: 67,535,016 (GRCm39) P305L probably damaging Het
Tulp3 G A 6: 128,300,017 (GRCm39) probably benign Het
Usp9x A G X: 12,989,747 (GRCm39) R776G possibly damaging Het
Virma T C 4: 11,513,505 (GRCm39) V453A probably damaging Het
Vmn2r103 A T 17: 20,032,077 (GRCm39) N617I probably damaging Het
Xirp1 G T 9: 119,846,058 (GRCm39) L942M probably damaging Het
Zc3h7b T G 15: 81,676,451 (GRCm39) V731G probably benign Het
Zfp534 C T 4: 147,759,175 (GRCm39) G498D probably benign Het
Zfp639 T C 3: 32,574,679 (GRCm39) Y435H probably damaging Het
Zxdc A G 6: 90,355,820 (GRCm39) H443R probably damaging Het
Other mutations in Golgb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01394:Golgb1 APN 16 36,751,926 (GRCm39) missense probably damaging 1.00
IGL01717:Golgb1 APN 16 36,735,864 (GRCm39) nonsense probably null
IGL01965:Golgb1 APN 16 36,738,282 (GRCm39) missense probably damaging 1.00
IGL02128:Golgb1 APN 16 36,736,666 (GRCm39) missense probably damaging 1.00
IGL02268:Golgb1 APN 16 36,733,490 (GRCm39) missense probably benign 0.25
IGL02383:Golgb1 APN 16 36,706,562 (GRCm39) missense probably benign 0.01
IGL02444:Golgb1 APN 16 36,728,178 (GRCm39) splice site probably benign
IGL02635:Golgb1 APN 16 36,735,375 (GRCm39) missense probably benign 0.00
IGL02655:Golgb1 APN 16 36,738,442 (GRCm39) missense probably damaging 0.98
IGL02887:Golgb1 APN 16 36,746,211 (GRCm39) missense probably damaging 0.99
IGL02937:Golgb1 APN 16 36,736,572 (GRCm39) missense probably damaging 1.00
IGL02973:Golgb1 APN 16 36,732,442 (GRCm39) missense possibly damaging 0.92
IGL02982:Golgb1 APN 16 36,746,172 (GRCm39) missense probably damaging 0.98
IGL03065:Golgb1 APN 16 36,733,228 (GRCm39) missense probably benign 0.11
IGL03109:Golgb1 APN 16 36,735,973 (GRCm39) missense possibly damaging 0.93
IGL03323:Golgb1 APN 16 36,733,815 (GRCm39) nonsense probably null
I2288:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
I2289:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
R0071:Golgb1 UTSW 16 36,735,865 (GRCm39) missense probably benign 0.00
R0071:Golgb1 UTSW 16 36,735,865 (GRCm39) missense probably benign 0.00
R0080:Golgb1 UTSW 16 36,718,973 (GRCm39) missense probably damaging 1.00
R0102:Golgb1 UTSW 16 36,695,830 (GRCm39) intron probably benign
R0242:Golgb1 UTSW 16 36,695,992 (GRCm39) nonsense probably null
R0242:Golgb1 UTSW 16 36,695,992 (GRCm39) nonsense probably null
R0276:Golgb1 UTSW 16 36,734,238 (GRCm39) missense probably damaging 1.00
R0394:Golgb1 UTSW 16 36,695,941 (GRCm39) intron probably benign
R0469:Golgb1 UTSW 16 36,751,997 (GRCm39) missense probably benign 0.41
R0522:Golgb1 UTSW 16 36,735,567 (GRCm39) frame shift probably null
R0575:Golgb1 UTSW 16 36,739,171 (GRCm39) missense probably benign
R0600:Golgb1 UTSW 16 36,736,633 (GRCm39) missense probably damaging 1.00
R0608:Golgb1 UTSW 16 36,736,692 (GRCm39) nonsense probably null
R0711:Golgb1 UTSW 16 36,739,152 (GRCm39) missense probably damaging 1.00
R0785:Golgb1 UTSW 16 36,719,152 (GRCm39) missense possibly damaging 0.95
R0893:Golgb1 UTSW 16 36,732,639 (GRCm39) missense possibly damaging 0.64
R1163:Golgb1 UTSW 16 36,736,488 (GRCm39) missense possibly damaging 0.50
R1208:Golgb1 UTSW 16 36,735,567 (GRCm39) frame shift probably null
R1315:Golgb1 UTSW 16 36,735,262 (GRCm39) missense probably benign 0.40
R1429:Golgb1 UTSW 16 36,720,925 (GRCm39) missense possibly damaging 0.93
R1505:Golgb1 UTSW 16 36,740,005 (GRCm39) missense possibly damaging 0.79
R1537:Golgb1 UTSW 16 36,719,150 (GRCm39) missense possibly damaging 0.89
R1610:Golgb1 UTSW 16 36,746,463 (GRCm39) missense probably benign 0.25
R1659:Golgb1 UTSW 16 36,707,979 (GRCm39) missense probably benign 0.01
R1769:Golgb1 UTSW 16 36,736,363 (GRCm39) missense probably damaging 1.00
R2105:Golgb1 UTSW 16 36,735,026 (GRCm39) missense probably benign
R2212:Golgb1 UTSW 16 36,707,709 (GRCm39) missense probably damaging 1.00
R2261:Golgb1 UTSW 16 36,713,722 (GRCm39) missense probably damaging 1.00
R2352:Golgb1 UTSW 16 36,718,921 (GRCm39) missense probably damaging 0.99
R2357:Golgb1 UTSW 16 36,732,370 (GRCm39) missense probably damaging 1.00
R2400:Golgb1 UTSW 16 36,738,828 (GRCm39) missense possibly damaging 0.62
R2513:Golgb1 UTSW 16 36,735,513 (GRCm39) missense possibly damaging 0.73
R3103:Golgb1 UTSW 16 36,715,211 (GRCm39) missense probably damaging 1.00
R3413:Golgb1 UTSW 16 36,707,709 (GRCm39) missense probably damaging 1.00
R3748:Golgb1 UTSW 16 36,739,274 (GRCm39) missense probably benign 0.00
R3847:Golgb1 UTSW 16 36,719,095 (GRCm39) missense probably benign 0.00
R3850:Golgb1 UTSW 16 36,719,095 (GRCm39) missense probably benign 0.00
R3936:Golgb1 UTSW 16 36,734,418 (GRCm39) nonsense probably null
R3975:Golgb1 UTSW 16 36,738,933 (GRCm39) missense probably damaging 0.99
R4025:Golgb1 UTSW 16 36,735,706 (GRCm39) missense probably benign 0.00
R4369:Golgb1 UTSW 16 36,737,269 (GRCm39) missense probably damaging 1.00
R4518:Golgb1 UTSW 16 36,749,625 (GRCm39) missense probably damaging 0.98
R4600:Golgb1 UTSW 16 36,738,987 (GRCm39) missense probably damaging 1.00
R4610:Golgb1 UTSW 16 36,738,987 (GRCm39) missense probably damaging 1.00
R4811:Golgb1 UTSW 16 36,711,781 (GRCm39) missense probably damaging 1.00
R4815:Golgb1 UTSW 16 36,733,477 (GRCm39) missense possibly damaging 0.79
R4835:Golgb1 UTSW 16 36,711,769 (GRCm39) missense possibly damaging 0.86
R4904:Golgb1 UTSW 16 36,713,748 (GRCm39) missense probably damaging 1.00
R4916:Golgb1 UTSW 16 36,736,480 (GRCm39) missense probably benign 0.05
R5121:Golgb1 UTSW 16 36,739,620 (GRCm39) missense probably damaging 0.99
R5133:Golgb1 UTSW 16 36,711,819 (GRCm39) missense possibly damaging 0.75
R5143:Golgb1 UTSW 16 36,719,051 (GRCm39) missense probably benign 0.09
R5185:Golgb1 UTSW 16 36,695,503 (GRCm39) unclassified probably benign
R5188:Golgb1 UTSW 16 36,738,827 (GRCm39) missense probably benign 0.13
R5260:Golgb1 UTSW 16 36,733,503 (GRCm39) missense probably benign 0.00
R5297:Golgb1 UTSW 16 36,695,978 (GRCm39) intron probably benign
R5386:Golgb1 UTSW 16 36,732,677 (GRCm39) nonsense probably null
R5438:Golgb1 UTSW 16 36,720,870 (GRCm39) missense probably benign 0.15
R5439:Golgb1 UTSW 16 36,720,870 (GRCm39) missense probably benign 0.15
R5494:Golgb1 UTSW 16 36,749,045 (GRCm39) missense possibly damaging 0.67
R5592:Golgb1 UTSW 16 36,746,125 (GRCm39) missense probably benign 0.02
R5740:Golgb1 UTSW 16 36,739,362 (GRCm39) missense probably damaging 0.99
R5862:Golgb1 UTSW 16 36,746,453 (GRCm39) splice site silent
R5928:Golgb1 UTSW 16 36,732,349 (GRCm39) missense probably damaging 1.00
R6009:Golgb1 UTSW 16 36,735,321 (GRCm39) missense probably damaging 1.00
R6062:Golgb1 UTSW 16 36,735,033 (GRCm39) missense possibly damaging 0.89
R6102:Golgb1 UTSW 16 36,733,227 (GRCm39) missense probably damaging 1.00
R6198:Golgb1 UTSW 16 36,713,757 (GRCm39) missense probably damaging 1.00
R6253:Golgb1 UTSW 16 36,735,984 (GRCm39) missense possibly damaging 0.77
R6254:Golgb1 UTSW 16 36,734,340 (GRCm39) missense probably damaging 0.99
R6321:Golgb1 UTSW 16 36,738,559 (GRCm39) nonsense probably null
R6700:Golgb1 UTSW 16 36,695,946 (GRCm39) intron probably benign
R6870:Golgb1 UTSW 16 36,738,565 (GRCm39) missense probably damaging 1.00
R6882:Golgb1 UTSW 16 36,734,352 (GRCm39) missense probably benign
R6944:Golgb1 UTSW 16 36,732,475 (GRCm39) missense probably benign
R7108:Golgb1 UTSW 16 36,734,083 (GRCm39) missense probably benign 0.01
R7124:Golgb1 UTSW 16 36,734,035 (GRCm39) missense probably benign 0.01
R7125:Golgb1 UTSW 16 36,738,325 (GRCm39) missense possibly damaging 0.85
R7187:Golgb1 UTSW 16 36,736,512 (GRCm39) missense probably benign 0.43
R7205:Golgb1 UTSW 16 36,695,663 (GRCm39) missense unknown
R7206:Golgb1 UTSW 16 36,734,111 (GRCm39) missense probably benign 0.41
R7233:Golgb1 UTSW 16 36,735,120 (GRCm39) missense possibly damaging 0.91
R7320:Golgb1 UTSW 16 36,736,313 (GRCm39) nonsense probably null
R7367:Golgb1 UTSW 16 36,718,908 (GRCm39) missense probably benign 0.00
R7408:Golgb1 UTSW 16 36,718,909 (GRCm39) missense probably damaging 0.98
R7419:Golgb1 UTSW 16 36,733,281 (GRCm39) missense possibly damaging 0.95
R7556:Golgb1 UTSW 16 36,736,155 (GRCm39) missense probably benign 0.03
R7599:Golgb1 UTSW 16 36,695,758 (GRCm39) missense unknown
R7673:Golgb1 UTSW 16 36,734,031 (GRCm39) missense probably benign 0.05
R7789:Golgb1 UTSW 16 36,695,761 (GRCm39) missense unknown
R7792:Golgb1 UTSW 16 36,739,092 (GRCm39) missense probably benign 0.43
R7830:Golgb1 UTSW 16 36,719,083 (GRCm39) missense possibly damaging 0.93
R7847:Golgb1 UTSW 16 36,752,282 (GRCm39) missense probably damaging 1.00
R7905:Golgb1 UTSW 16 36,734,047 (GRCm39) missense probably benign
R7944:Golgb1 UTSW 16 36,734,466 (GRCm39) missense probably benign 0.02
R7945:Golgb1 UTSW 16 36,734,466 (GRCm39) missense probably benign 0.02
R7950:Golgb1 UTSW 16 36,735,786 (GRCm39) missense probably benign 0.13
R8040:Golgb1 UTSW 16 36,733,841 (GRCm39) missense possibly damaging 0.85
R8077:Golgb1 UTSW 16 36,738,995 (GRCm39) missense probably damaging 0.99
R8181:Golgb1 UTSW 16 36,737,192 (GRCm39) missense probably damaging 1.00
R8370:Golgb1 UTSW 16 36,732,679 (GRCm39) missense probably benign 0.00
R8684:Golgb1 UTSW 16 36,734,764 (GRCm39) missense possibly damaging 0.92
R8725:Golgb1 UTSW 16 36,739,563 (GRCm39) missense probably damaging 1.00
R8727:Golgb1 UTSW 16 36,739,563 (GRCm39) missense probably damaging 1.00
R8738:Golgb1 UTSW 16 36,736,675 (GRCm39) missense probably damaging 1.00
R8785:Golgb1 UTSW 16 36,740,106 (GRCm39) missense probably damaging 0.99
R8824:Golgb1 UTSW 16 36,736,051 (GRCm39) missense probably benign
R8825:Golgb1 UTSW 16 36,739,809 (GRCm39) missense probably benign 0.00
R8940:Golgb1 UTSW 16 36,736,759 (GRCm39) missense probably damaging 1.00
R8962:Golgb1 UTSW 16 36,733,978 (GRCm39) missense probably damaging 1.00
R9245:Golgb1 UTSW 16 36,739,181 (GRCm39) nonsense probably null
R9365:Golgb1 UTSW 16 36,736,124 (GRCm39) missense probably damaging 1.00
R9612:Golgb1 UTSW 16 36,739,967 (GRCm39) missense probably benign 0.41
R9620:Golgb1 UTSW 16 36,739,811 (GRCm39) missense probably benign
R9691:Golgb1 UTSW 16 36,718,996 (GRCm39) missense probably damaging 1.00
R9747:Golgb1 UTSW 16 36,713,769 (GRCm39) missense probably damaging 1.00
V1662:Golgb1 UTSW 16 36,718,904 (GRCm39) missense probably benign 0.00
X0067:Golgb1 UTSW 16 36,734,665 (GRCm39) nonsense probably null
Z1088:Golgb1 UTSW 16 36,740,104 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGCTCTGCAGGTATTGTTGC -3'
(R):5'- AGGGAAGGGAGGCATTCTTC -3'

Sequencing Primer
(F):5'- CTGCTGAGCGATTGATAGAGACTC -3'
(R):5'- AGGCATTCTTCCCACCAGG -3'
Posted On 2015-10-08