Incidental Mutation 'R4660:Vmn2r103'
ID 352806
Institutional Source Beutler Lab
Gene Symbol Vmn2r103
Ensembl Gene ENSMUSG00000091771
Gene Name vomeronasal 2, receptor 103
Synonyms EG627636
MMRRC Submission 041920-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.058) question?
Stock # R4660 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 19993625-20032798 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 20032077 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Isoleucine at position 617 (N617I)
Ref Sequence ENSEMBL: ENSMUSP00000126756 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172203]
AlphaFold E9PWW0
Predicted Effect probably damaging
Transcript: ENSMUST00000172203
AA Change: N617I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126756
Gene: ENSMUSG00000091771
AA Change: N617I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 449 1.3e-37 PFAM
Pfam:NCD3G 509 562 3.5e-22 PFAM
Pfam:7tm_3 595 830 1.1e-51 PFAM
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (102/106)
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d T C 2: 131,403,062 (GRCm39) T343A probably damaging Het
Angptl4 A T 17: 33,996,249 (GRCm39) probably benign Het
Antxr2 A T 5: 98,151,913 (GRCm39) probably null Het
Ap1b1 T A 11: 4,966,760 (GRCm39) V145E probably damaging Het
Asns G T 6: 7,678,012 (GRCm39) N355K probably benign Het
Asxl3 A G 18: 22,649,534 (GRCm39) T508A probably benign Het
B4galt7 T A 13: 55,752,111 (GRCm39) V54D possibly damaging Het
Bach2 C T 4: 32,562,777 (GRCm39) P415S probably benign Het
Bbs9 G A 9: 22,490,063 (GRCm39) R278Q probably benign Het
Blzf1 C T 1: 164,134,062 (GRCm39) probably benign Het
Btd A T 14: 31,389,760 (GRCm39) T494S probably benign Het
Casp9 C T 4: 141,540,934 (GRCm39) T434I probably benign Het
Cavin2 T C 1: 51,340,510 (GRCm39) S396P probably benign Het
Ccnk C T 12: 108,168,575 (GRCm39) probably benign Het
Cldn8 G A 16: 88,359,296 (GRCm39) H210Y probably benign Het
Clip1 G A 5: 123,717,437 (GRCm39) T1284I probably damaging Het
Coch T C 12: 51,642,268 (GRCm39) V80A probably benign Het
Cttnbp2 A G 6: 18,406,536 (GRCm39) S1052P probably benign Het
Cyp2j7 C T 4: 96,083,579 (GRCm39) R457K probably benign Het
Dalrd3 T C 9: 108,447,568 (GRCm39) S129P probably benign Het
Ddx10 A G 9: 53,147,698 (GRCm39) probably null Het
Dnah7b A T 1: 46,328,696 (GRCm39) T3143S probably damaging Het
Dynlt1b A G 17: 6,699,279 (GRCm39) T10A probably benign Het
Eif2s2 G A 2: 154,730,189 (GRCm39) T36I probably benign Het
Fam118b A T 9: 35,146,551 (GRCm39) H105Q possibly damaging Het
Galntl5 T A 5: 25,408,377 (GRCm39) I250N probably damaging Het
Gm11544 C T 11: 94,736,306 (GRCm39) noncoding transcript Het
Gm5709 C T 3: 59,526,124 (GRCm39) noncoding transcript Het
Golgb1 T A 16: 36,707,980 (GRCm39) I107N probably damaging Het
Gpld1 T C 13: 25,166,586 (GRCm39) probably null Het
Grik1 T A 16: 87,720,019 (GRCm39) T768S probably damaging Het
H2-T23 T G 17: 36,341,108 (GRCm39) Q349P probably damaging Het
Ing3 A T 6: 21,973,710 (GRCm39) probably benign Het
Iqgap3 T G 3: 88,027,483 (GRCm39) L702R probably damaging Het
Itga8 A G 2: 12,270,069 (GRCm39) V139A probably damaging Het
Jam2 G A 16: 84,609,840 (GRCm39) V151M probably damaging Het
Kbtbd12 T C 6: 88,594,772 (GRCm39) I353V probably benign Het
Kif27 T C 13: 58,471,730 (GRCm39) E786G probably damaging Het
Lingo4 T A 3: 94,310,672 (GRCm39) S537T probably benign Het
Lipo3 C T 19: 33,598,360 (GRCm39) probably benign Het
Lrrc3 G T 10: 77,729,866 (GRCm39) probably benign Het
Ltbp3 T A 19: 5,798,814 (GRCm39) probably null Het
Lyg1 T A 1: 37,985,942 (GRCm39) probably benign Het
Mcm9 T C 10: 53,424,623 (GRCm39) I656V probably benign Het
Mfsd8 T A 3: 40,776,372 (GRCm39) I427F probably benign Het
Mga T A 2: 119,769,104 (GRCm39) probably benign Het
Miga1 A G 3: 151,993,155 (GRCm39) L422P probably damaging Het
Msantd3 A G 4: 48,552,536 (GRCm39) I42V probably benign Het
Mybbp1a T C 11: 72,336,538 (GRCm39) V510A probably benign Het
Nccrp1 G T 7: 28,245,760 (GRCm39) P135T probably damaging Het
Neb T A 2: 52,145,600 (GRCm39) M2975L possibly damaging Het
Nfxl1 A T 5: 72,710,011 (GRCm39) I171N probably damaging Het
Odad2 A G 18: 7,211,609 (GRCm39) V755A possibly damaging Het
Or10q3 T C 19: 11,848,412 (GRCm39) H56R possibly damaging Het
Or12j5 A T 7: 140,083,933 (GRCm39) F146L probably benign Het
Or13a19 T C 7: 139,903,325 (GRCm39) F238L possibly damaging Het
Otop1 T G 5: 38,457,368 (GRCm39) S376A possibly damaging Het
Pdgfra T C 5: 75,322,932 (GRCm39) V10A possibly damaging Het
Pgs1 T C 11: 117,910,503 (GRCm39) V538A probably damaging Het
Ppa2 A T 3: 133,032,445 (GRCm39) T97S probably damaging Het
Pramel22 T A 4: 143,380,847 (GRCm39) Y392F probably benign Het
Pramel26 A G 4: 143,538,435 (GRCm39) S179P probably benign Het
Prdm10 G A 9: 31,238,624 (GRCm39) C172Y probably damaging Het
Prrc2c G A 1: 162,508,464 (GRCm39) P1091L probably damaging Het
Pthlh G A 6: 147,158,796 (GRCm39) R55C probably damaging Het
Ptpn9 A T 9: 56,943,782 (GRCm39) T105S probably benign Het
Rundc1 T A 11: 101,324,830 (GRCm39) V512E possibly damaging Het
Scrib G A 15: 75,937,185 (GRCm39) S307L probably damaging Het
Sec23ip A G 7: 128,352,010 (GRCm39) S26G probably null Het
Sec61a2 A G 2: 5,878,504 (GRCm39) probably benign Het
Sema3c T C 5: 17,877,511 (GRCm39) V206A probably damaging Het
Sgk2 C T 2: 162,839,763 (GRCm39) H124Y possibly damaging Het
Slc26a6 C T 9: 108,738,540 (GRCm39) T592I probably damaging Het
Slc5a11 T C 7: 122,864,486 (GRCm39) Y361H probably damaging Het
Smc6 T C 12: 11,324,008 (GRCm39) V51A probably damaging Het
Stab1 A T 14: 30,876,872 (GRCm39) N817K possibly damaging Het
Swt1 A T 1: 151,283,348 (GRCm39) D336E probably benign Het
Taf13 T A 3: 108,480,293 (GRCm39) probably benign Het
Tmub2 T C 11: 102,175,845 (GRCm39) probably benign Het
Tnf A G 17: 35,419,156 (GRCm39) S209P probably benign Het
Try10 A G 6: 41,334,761 (GRCm39) Y229C probably damaging Het
Ttbk1 G T 17: 46,788,714 (GRCm39) Y183* probably null Het
Ttc17 A T 2: 94,194,774 (GRCm39) I533N possibly damaging Het
Tubb6 C T 18: 67,535,016 (GRCm39) P305L probably damaging Het
Tulp3 G A 6: 128,300,017 (GRCm39) probably benign Het
Usp9x A G X: 12,989,747 (GRCm39) R776G possibly damaging Het
Virma T C 4: 11,513,505 (GRCm39) V453A probably damaging Het
Xirp1 G T 9: 119,846,058 (GRCm39) L942M probably damaging Het
Zc3h7b T G 15: 81,676,451 (GRCm39) V731G probably benign Het
Zfp534 C T 4: 147,759,175 (GRCm39) G498D probably benign Het
Zfp639 T C 3: 32,574,679 (GRCm39) Y435H probably damaging Het
Zxdc A G 6: 90,355,820 (GRCm39) H443R probably damaging Het
Other mutations in Vmn2r103
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Vmn2r103 APN 17 20,013,364 (GRCm39) missense probably damaging 0.98
IGL00939:Vmn2r103 APN 17 20,015,227 (GRCm39) missense probably benign 0.00
IGL01120:Vmn2r103 APN 17 20,013,259 (GRCm39) missense probably benign 0.06
IGL01403:Vmn2r103 APN 17 20,013,229 (GRCm39) missense probably benign
IGL01404:Vmn2r103 APN 17 20,032,696 (GRCm39) missense probably damaging 1.00
IGL01713:Vmn2r103 APN 17 20,014,330 (GRCm39) missense probably damaging 1.00
IGL01802:Vmn2r103 APN 17 20,019,470 (GRCm39) missense probably benign
IGL02251:Vmn2r103 APN 17 20,014,231 (GRCm39) missense possibly damaging 0.84
IGL02466:Vmn2r103 APN 17 19,993,631 (GRCm39) missense probably benign
IGL02555:Vmn2r103 APN 17 20,031,873 (GRCm39) missense probably damaging 1.00
IGL02668:Vmn2r103 APN 17 20,014,389 (GRCm39) missense probably benign 0.03
IGL02715:Vmn2r103 APN 17 20,014,218 (GRCm39) missense probably damaging 0.97
IGL02735:Vmn2r103 APN 17 20,032,510 (GRCm39) missense probably benign 0.27
IGL03101:Vmn2r103 APN 17 19,993,782 (GRCm39) missense probably damaging 0.98
R0003:Vmn2r103 UTSW 17 20,032,241 (GRCm39) missense probably damaging 0.99
R0052:Vmn2r103 UTSW 17 20,031,903 (GRCm39) missense probably benign 0.01
R0375:Vmn2r103 UTSW 17 20,013,726 (GRCm39) missense probably benign 0.12
R0375:Vmn2r103 UTSW 17 20,013,121 (GRCm39) missense probably benign 0.06
R0755:Vmn2r103 UTSW 17 19,993,830 (GRCm39) missense probably benign 0.01
R0837:Vmn2r103 UTSW 17 20,014,189 (GRCm39) missense probably damaging 0.99
R1345:Vmn2r103 UTSW 17 20,014,509 (GRCm39) missense probably damaging 1.00
R1396:Vmn2r103 UTSW 17 20,013,230 (GRCm39) missense probably benign
R1488:Vmn2r103 UTSW 17 20,013,922 (GRCm39) missense probably damaging 0.97
R1533:Vmn2r103 UTSW 17 19,993,662 (GRCm39) missense probably benign 0.01
R1590:Vmn2r103 UTSW 17 20,014,496 (GRCm39) missense probably benign
R1928:Vmn2r103 UTSW 17 20,032,029 (GRCm39) missense possibly damaging 0.95
R1942:Vmn2r103 UTSW 17 20,032,562 (GRCm39) missense probably benign 0.02
R2071:Vmn2r103 UTSW 17 20,014,056 (GRCm39) missense probably benign
R2219:Vmn2r103 UTSW 17 20,013,909 (GRCm39) missense probably damaging 1.00
R2442:Vmn2r103 UTSW 17 19,993,793 (GRCm39) missense probably benign 0.00
R2889:Vmn2r103 UTSW 17 20,013,862 (GRCm39) missense probably damaging 1.00
R3762:Vmn2r103 UTSW 17 20,032,411 (GRCm39) missense probably damaging 0.98
R4014:Vmn2r103 UTSW 17 20,013,866 (GRCm39) missense possibly damaging 0.67
R4331:Vmn2r103 UTSW 17 20,014,495 (GRCm39) missense probably benign 0.00
R4630:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4631:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4632:Vmn2r103 UTSW 17 20,013,958 (GRCm39) missense probably benign 0.04
R4801:Vmn2r103 UTSW 17 20,015,338 (GRCm39) missense probably benign 0.06
R4802:Vmn2r103 UTSW 17 20,015,338 (GRCm39) missense probably benign 0.06
R4931:Vmn2r103 UTSW 17 20,032,031 (GRCm39) missense probably benign 0.01
R4995:Vmn2r103 UTSW 17 19,993,773 (GRCm39) missense probably benign 0.14
R5309:Vmn2r103 UTSW 17 20,013,296 (GRCm39) missense probably benign 0.01
R5312:Vmn2r103 UTSW 17 20,013,296 (GRCm39) missense probably benign 0.01
R5329:Vmn2r103 UTSW 17 20,032,433 (GRCm39) missense probably damaging 1.00
R5611:Vmn2r103 UTSW 17 20,013,904 (GRCm39) missense probably damaging 0.99
R5684:Vmn2r103 UTSW 17 20,013,251 (GRCm39) missense probably benign 0.02
R5715:Vmn2r103 UTSW 17 20,015,201 (GRCm39) missense probably benign 0.17
R5907:Vmn2r103 UTSW 17 20,032,715 (GRCm39) missense possibly damaging 0.67
R6029:Vmn2r103 UTSW 17 20,014,478 (GRCm39) nonsense probably null
R6114:Vmn2r103 UTSW 17 20,032,587 (GRCm39) missense probably damaging 0.99
R6285:Vmn2r103 UTSW 17 20,032,406 (GRCm39) missense probably benign
R6292:Vmn2r103 UTSW 17 20,013,866 (GRCm39) missense possibly damaging 0.67
R6334:Vmn2r103 UTSW 17 20,014,344 (GRCm39) missense probably damaging 0.97
R6501:Vmn2r103 UTSW 17 20,032,166 (GRCm39) missense probably benign 0.29
R6710:Vmn2r103 UTSW 17 20,032,239 (GRCm39) missense probably damaging 1.00
R6774:Vmn2r103 UTSW 17 19,993,773 (GRCm39) missense probably benign 0.14
R6981:Vmn2r103 UTSW 17 20,013,739 (GRCm39) missense probably benign 0.00
R7768:Vmn2r103 UTSW 17 20,032,314 (GRCm39) missense probably damaging 0.99
R7816:Vmn2r103 UTSW 17 20,014,476 (GRCm39) missense probably benign 0.06
R7885:Vmn2r103 UTSW 17 20,013,385 (GRCm39) missense probably benign 0.25
R8002:Vmn2r103 UTSW 17 20,019,511 (GRCm39) missense probably damaging 1.00
R8031:Vmn2r103 UTSW 17 20,013,759 (GRCm39) missense probably benign 0.00
R8140:Vmn2r103 UTSW 17 20,032,058 (GRCm39) missense probably damaging 1.00
R8186:Vmn2r103 UTSW 17 20,032,205 (GRCm39) missense probably damaging 1.00
R8559:Vmn2r103 UTSW 17 20,032,646 (GRCm39) missense probably benign 0.01
R9413:Vmn2r103 UTSW 17 20,032,158 (GRCm39) missense possibly damaging 0.54
R9591:Vmn2r103 UTSW 17 20,031,921 (GRCm39) missense possibly damaging 0.70
R9652:Vmn2r103 UTSW 17 20,014,027 (GRCm39) missense probably benign 0.01
R9680:Vmn2r103 UTSW 17 20,019,525 (GRCm39) nonsense probably null
R9743:Vmn2r103 UTSW 17 20,032,475 (GRCm39) missense probably damaging 1.00
Z1088:Vmn2r103 UTSW 17 20,015,309 (GRCm39) missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- TATACCAGTGTGTGAAGTGTCC -3'
(R):5'- CCTGGAAAACTGACCTTAAAGGC -3'

Sequencing Primer
(F):5'- AGTGTCCAGAAGGTCATTATGC -3'
(R):5'- CAAGGACCACAGTAATAGCTTTGGC -3'
Posted On 2015-10-08