Incidental Mutation 'R4660:H2-T23'
ID352809
Institutional Source Beutler Lab
Gene Symbol H2-T23
Ensembl Gene ENSMUSG00000067212
Gene Namehistocompatibility 2, T region locus 23
Synonyms37b, T18c(37), 37c, Qa-1, Qed-1, T23b, T18c, T23d, H-2T23, Qa1
MMRRC Submission 041920-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.061) question?
Stock #R4660 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location36029773-36032855 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 36030216 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Proline at position 349 (Q349P)
Ref Sequence ENSEMBL: ENSMUSP00000099739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102678]
PDB Structure
Structure of the MHC class Ib molecule Qa-1b [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000102678
AA Change: Q349P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000099739
Gene: ENSMUSG00000067212
AA Change: Q349P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:MHC_I 21 199 1.9e-93 PFAM
IGc1 218 289 1.89e-22 SMART
transmembrane domain 304 326 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173900
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174471
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174839
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.0%
Validation Efficiency 96% (102/106)
MGI Phenotype PHENOTYPE: CD4+ T cells from mice with a homozygous null mutation have enhanced responses after infection or immunization, are resistant to suppressor activity mediated by a subset of CD8+ T cells, but are more susceptible to NK cell lysis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 92 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adra1d T C 2: 131,561,142 T343A probably damaging Het
Angptl4 A T 17: 33,777,275 probably benign Het
Antxr2 A T 5: 98,004,054 probably null Het
Ap1b1 T A 11: 5,016,760 V145E probably damaging Het
Armc4 A G 18: 7,211,609 V755A possibly damaging Het
Asns G T 6: 7,678,012 N355K probably benign Het
Asxl3 A G 18: 22,516,477 T508A probably benign Het
B4galt7 T A 13: 55,604,298 V54D possibly damaging Het
Bach2 C T 4: 32,562,777 P415S probably benign Het
Bbs9 G A 9: 22,578,767 R278Q probably benign Het
Blzf1 C T 1: 164,306,493 probably benign Het
Btd A T 14: 31,667,803 T494S probably benign Het
Casp9 C T 4: 141,813,623 T434I probably benign Het
Cavin2 T C 1: 51,301,351 S396P probably benign Het
Ccnk C T 12: 108,202,316 probably benign Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Clip1 G A 5: 123,579,374 T1284I probably damaging Het
Coch T C 12: 51,595,485 V80A probably benign Het
Cttnbp2 A G 6: 18,406,537 S1052P probably benign Het
Cyp2j7 C T 4: 96,195,342 R457K probably benign Het
Dalrd3 T C 9: 108,570,369 S129P probably benign Het
Ddx10 A G 9: 53,236,398 probably null Het
Dnah7b A T 1: 46,289,536 T3143S probably damaging Het
Dynlt1b A G 17: 6,431,880 T10A probably benign Het
Eif2s2 G A 2: 154,888,269 T36I probably benign Het
Fam118b A T 9: 35,235,255 H105Q possibly damaging Het
Galntl5 T A 5: 25,203,379 I250N probably damaging Het
Gm11544 C T 11: 94,845,480 noncoding transcript Het
Gm13084 A G 4: 143,811,865 S179P probably benign Het
Gm13088 T A 4: 143,654,277 Y392F probably benign Het
Gm5709 C T 3: 59,618,703 noncoding transcript Het
Golgb1 T A 16: 36,887,618 I107N probably damaging Het
Gpld1 T C 13: 24,982,603 probably null Het
Grik1 T A 16: 87,923,131 T768S probably damaging Het
Ing3 A T 6: 21,973,711 probably benign Het
Iqgap3 T G 3: 88,120,176 L702R probably damaging Het
Itga8 A G 2: 12,265,258 V139A probably damaging Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Kbtbd12 T C 6: 88,617,790 I353V probably benign Het
Kif27 T C 13: 58,323,916 E786G probably damaging Het
Lingo4 T A 3: 94,403,365 S537T probably benign Het
Lipo3 C T 19: 33,620,960 probably benign Het
Lrrc3 G T 10: 77,894,032 probably benign Het
Ltbp3 T A 19: 5,748,786 probably null Het
Lyg1 T A 1: 37,946,861 probably benign Het
Mcm9 T C 10: 53,548,527 I656V probably benign Het
Mfsd8 T A 3: 40,821,937 I427F probably benign Het
Mga T A 2: 119,938,623 probably benign Het
Miga1 A G 3: 152,287,518 L422P probably damaging Het
Msantd3 A G 4: 48,552,536 I42V probably benign Het
Mybbp1a T C 11: 72,445,712 V510A probably benign Het
Nccrp1 G T 7: 28,546,335 P135T probably damaging Het
Neb T A 2: 52,255,588 M2975L possibly damaging Het
Nfxl1 A T 5: 72,552,668 I171N probably damaging Het
Olfr1419 T C 19: 11,871,048 H56R possibly damaging Het
Olfr525 T C 7: 140,323,412 F238L possibly damaging Het
Olfr536 A T 7: 140,504,020 F146L probably benign Het
Otop1 T G 5: 38,300,024 S376A possibly damaging Het
Pdgfra T C 5: 75,162,271 V10A possibly damaging Het
Pgs1 T C 11: 118,019,677 V538A probably damaging Het
Ppa2 A T 3: 133,326,684 T97S probably damaging Het
Prdm10 G A 9: 31,327,328 C172Y probably damaging Het
Prrc2c G A 1: 162,680,895 P1091L probably damaging Het
Pthlh G A 6: 147,257,298 R55C probably damaging Het
Ptpn9 A T 9: 57,036,498 T105S probably benign Het
Rundc1 T A 11: 101,434,004 V512E possibly damaging Het
Scrib G A 15: 76,065,336 S307L probably damaging Het
Sec23ip A G 7: 128,750,286 S26G probably null Het
Sec61a2 A G 2: 5,873,693 probably benign Het
Sema3c T C 5: 17,672,513 V206A probably damaging Het
Sgk2 C T 2: 162,997,843 H124Y possibly damaging Het
Slc26a6 C T 9: 108,861,341 T592I probably damaging Het
Slc5a11 T C 7: 123,265,263 Y361H probably damaging Het
Smc6 T C 12: 11,274,007 V51A probably damaging Het
Stab1 A T 14: 31,154,915 N817K possibly damaging Het
Swt1 A T 1: 151,407,597 D336E probably benign Het
Taf13 T A 3: 108,572,977 probably benign Het
Tmub2 T C 11: 102,285,019 probably benign Het
Tnf A G 17: 35,200,180 S209P probably benign Het
Try10 A G 6: 41,357,827 Y229C probably damaging Het
Ttbk1 G T 17: 46,477,788 Y183* probably null Het
Ttc17 A T 2: 94,364,429 I533N possibly damaging Het
Tubb6 C T 18: 67,401,946 P305L probably damaging Het
Tulp3 G A 6: 128,323,054 probably benign Het
Usp9x A G X: 13,123,508 R776G possibly damaging Het
Virma T C 4: 11,513,505 V453A probably damaging Het
Vmn2r103 A T 17: 19,811,815 N617I probably damaging Het
Xirp1 G T 9: 120,016,992 L942M probably damaging Het
Zc3h7b T G 15: 81,792,250 V731G probably benign Het
Zfp534 C T 4: 147,674,718 G498D probably benign Het
Zfp639 T C 3: 32,520,530 Y435H probably damaging Het
Zxdc A G 6: 90,378,838 H443R probably damaging Het
Other mutations in H2-T23
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:H2-T23 APN 17 36031781 missense probably damaging 1.00
IGL01685:H2-T23 APN 17 36032644 missense probably benign 0.29
IGL02756:H2-T23 APN 17 36031688 missense probably damaging 1.00
IGL03036:H2-T23 APN 17 36032357 missense possibly damaging 0.73
LCD18:H2-T23 UTSW 17 36031216 intron probably benign
R0539:H2-T23 UTSW 17 36032141 splice site probably benign
R0845:H2-T23 UTSW 17 36030583 missense probably benign 0.00
R1727:H2-T23 UTSW 17 36031653 missense possibly damaging 0.52
R2044:H2-T23 UTSW 17 36032191 missense probably damaging 1.00
R3121:H2-T23 UTSW 17 36030963 missense probably benign 0.13
R3122:H2-T23 UTSW 17 36030963 missense probably benign 0.13
R3943:H2-T23 UTSW 17 36030643 missense probably benign 0.01
R3944:H2-T23 UTSW 17 36030643 missense probably benign 0.01
R4492:H2-T23 UTSW 17 36032166 missense probably damaging 0.97
R4669:H2-T23 UTSW 17 36031798 missense probably damaging 1.00
R4740:H2-T23 UTSW 17 36032124 intron probably benign
R5151:H2-T23 UTSW 17 36032338 missense probably damaging 1.00
R5196:H2-T23 UTSW 17 36032607 critical splice donor site probably null
R5237:H2-T23 UTSW 17 36030366 splice site probably null
R5307:H2-T23 UTSW 17 36032216 missense probably benign 0.00
R5336:H2-T23 UTSW 17 36031658 missense possibly damaging 0.85
R5646:H2-T23 UTSW 17 36031803 missense possibly damaging 0.49
R5800:H2-T23 UTSW 17 36031604 intron probably benign
R6013:H2-T23 UTSW 17 36030582 missense probably benign 0.00
R6081:H2-T23 UTSW 17 36031815 missense possibly damaging 0.90
R6382:H2-T23 UTSW 17 36031832 missense probably damaging 1.00
R7043:H2-T23 UTSW 17 36031911 missense probably damaging 1.00
R7134:H2-T23 UTSW 17 36031817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGGCGCTGTAACTCCCTG -3'
(R):5'- ATGCTCATGTTCTAGGTAAGTGC -3'

Sequencing Primer
(F):5'- TGTCAGTGCTAGGAATTGAACCCC -3'
(R):5'- CTCATGTTCTAGGTAAGTGCGAGAG -3'
Posted On2015-10-08