Incidental Mutation 'R4661:Frem2'
ID352827
Institutional Source Beutler Lab
Gene Symbol Frem2
Ensembl Gene ENSMUSG00000037016
Gene NameFras1 related extracellular matrix protein 2
Synonymsmy, ne, 6030440P17Rik, b2b1562Clo, 8430406N05Rik
MMRRC Submission 041600-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4661 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location53513938-53657355 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 53655443 bp
ZygosityHeterozygous
Amino Acid Change Proline to Threonine at position 548 (P548T)
Ref Sequence ENSEMBL: ENSMUSP00000088670 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091137]
Predicted Effect probably damaging
Transcript: ENSMUST00000091137
AA Change: P548T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000088670
Gene: ENSMUSG00000037016
AA Change: P548T

DomainStartEndE-ValueType
signal peptide 1 39 N/A INTRINSIC
Pfam:Cadherin_3 249 388 4.3e-9 PFAM
Pfam:Cadherin_3 376 532 3e-34 PFAM
Pfam:Cadherin_3 516 665 7.5e-24 PFAM
Pfam:Cadherin_3 632 798 1.6e-21 PFAM
Pfam:Cadherin_3 763 910 1.2e-25 PFAM
Pfam:Cadherin_3 879 1027 5.1e-18 PFAM
Pfam:Cadherin_3 1015 1159 2.2e-20 PFAM
CA 1202 1293 4.8e-1 SMART
Pfam:Cadherin_3 1392 1503 9.8e-24 PFAM
Pfam:Cadherin_3 1504 1612 6.2e-28 PFAM
Pfam:Cadherin_3 1613 1743 5.3e-20 PFAM
Calx_beta 1748 1847 1.5e-5 SMART
Calx_beta 1860 1971 9.47e-12 SMART
Calx_beta 1985 2092 1.65e-11 SMART
Calx_beta 2105 2209 1.99e-5 SMART
Calx_beta 2227 2331 6.9e-14 SMART
transmembrane domain 3103 3125 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199323
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral membrane protein containing numerous CSPG (chondroitin sulfate proteoglycan element) repeats and Calx-beta domains. The encoded protein localizes to the basement membrane, forming a ternary complex that plays a role in epidermal-dermal interactions. This protein is important for the integrity of skin and renal epithelia. Mutations in this gene are associated with Fraser syndrome. [provided by RefSeq, Apr 2014]
PHENOTYPE: Mice homozygous for mutations at this locus display a significant amount of embryonic lethality due to hemorrhaging of embryonic blisters. Kidney development is severely affected and syndactyly is common. Phenotypes of homozygous mutants are indistinguishable from those of Fras1 homozygous mutant. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T C 9: 44,287,330 N42D probably damaging Het
Adamdec1 G A 14: 68,570,113 T366I probably damaging Het
Adamts7 C A 9: 90,193,330 H1038Q probably benign Het
Aff3 T C 1: 38,627,128 D5G possibly damaging Het
Amhr2 A T 15: 102,454,253 D485V probably damaging Het
Arhgap35 A T 7: 16,564,738 F134Y probably damaging Het
Asxl3 A G 18: 22,516,477 T508A probably benign Het
Atp10a TGGCGGCGGC TGGCGGC 7: 58,658,500 probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Atp9a A G 2: 168,637,672 F928L possibly damaging Het
BC034090 A T 1: 155,232,475 D13E probably damaging Het
Bco1 A G 8: 117,129,241 E425G probably benign Het
Brsk1 T C 7: 4,707,299 S436P possibly damaging Het
C1s1 T C 6: 124,536,490 I193V probably benign Het
Calb2 A G 8: 110,168,077 F21L probably benign Het
Catsperz T G 19: 6,924,803 T108P probably benign Het
Cep57l1 T A 10: 41,719,771 D329V possibly damaging Het
Cfdp1 A G 8: 111,830,945 F188S probably benign Het
Chrna2 G A 14: 66,148,843 G146D probably damaging Het
Col6a1 A C 10: 76,714,672 F520V unknown Het
Cyb5d2 C A 11: 72,778,945 V43L probably damaging Het
Cyp2c40 T C 19: 39,786,846 T321A probably benign Het
Dnajc16 A C 4: 141,763,548 Y764D probably damaging Het
Dsg1a G A 18: 20,340,533 V888M probably damaging Het
F5 A C 1: 164,184,920 T468P probably damaging Het
Faap24 A G 7: 35,395,084 M97T probably benign Het
Fam227b A T 2: 126,007,310 I334N probably damaging Het
Gfm1 A G 3: 67,433,398 E94G probably damaging Het
Gm17606 A T 14: 54,648,239 probably benign Het
Gnb2 A T 5: 137,530,253 M1K probably null Het
Gys1 G A 7: 45,454,834 A544T probably damaging Het
Hdac5 T C 11: 102,205,849 Y230C probably damaging Het
Hunk A T 16: 90,447,308 probably null Het
Ifnl2 A G 7: 28,510,210 F51L probably damaging Het
Itpr1 T C 6: 108,410,931 probably null Het
Kcnj1 A G 9: 32,396,622 Y114C probably benign Het
Kdm4b T A 17: 56,399,459 S322T probably damaging Het
Kif27 T C 13: 58,323,916 E786G probably damaging Het
Kif6 T C 17: 49,753,881 V414A probably benign Het
L1td1 A G 4: 98,733,624 K141R possibly damaging Het
Loxhd1 A G 18: 77,402,885 I1394V possibly damaging Het
Lrfn5 A T 12: 61,839,647 M74L probably damaging Het
Lrp6 C T 6: 134,511,267 D289N probably benign Het
Mroh7 A G 4: 106,691,513 probably null Het
Muc4 A C 16: 32,769,277 E2885A possibly damaging Het
Myo18b G T 5: 112,875,175 probably benign Het
Ncln G A 10: 81,493,068 A172V probably damaging Het
Nek9 G A 12: 85,320,892 T335M possibly damaging Het
Notch2 A G 3: 98,135,513 Y1398C probably damaging Het
Olfr472 A T 7: 107,902,981 H88L probably benign Het
Olfr710 T A 7: 106,944,867 I45F probably damaging Het
Olfr981 A T 9: 40,022,527 I45F probably damaging Het
Pax2 G A 19: 44,760,937 V40M probably damaging Het
Pde6c A G 19: 38,169,439 Y637C probably damaging Het
Plppr5 A G 3: 117,620,969 I80V probably damaging Het
Pold1 G T 7: 44,532,809 P1100T probably damaging Het
Prune2 T C 19: 17,000,023 Y41H probably damaging Het
Rgl2 C T 17: 33,933,226 A329V possibly damaging Het
Rilp T A 11: 75,511,424 Y250N probably damaging Het
Rilpl1 A G 5: 124,514,688 V19A probably benign Het
Rtp3 T C 9: 110,986,451 probably null Het
Rufy4 A G 1: 74,133,107 K246E probably damaging Het
Saraf C A 8: 34,168,462 A306E probably damaging Het
Slc26a8 A T 17: 28,638,684 N828K probably benign Het
Src C T 2: 157,469,932 P527S probably damaging Het
Susd3 C T 13: 49,231,302 probably null Het
Syngap1 T C 17: 26,966,906 L1270P probably damaging Het
Taf1c G A 8: 119,598,850 P758S probably damaging Het
Tenm2 A T 11: 36,024,448 N2087K probably damaging Het
Tfrc A T 16: 32,630,151 I703F probably damaging Het
Thap1 C G 8: 26,160,846 T48S probably benign Het
Tspear T C 10: 77,866,329 F199L probably benign Het
Usp17lc A T 7: 103,418,590 H364L probably benign Het
Usp9x A G X: 13,123,508 R776G possibly damaging Homo
Vmn1r1 T C 1: 182,157,224 E292G possibly damaging Het
Vmn1r125 T G 7: 21,272,627 V150G probably damaging Het
Vmn1r167 A T 7: 23,504,692 L300I probably damaging Het
Vmn2r106 A C 17: 20,267,623 I838S probably benign Het
Wdr64 A T 1: 175,726,494 S197C probably damaging Het
Zfp248 A T 6: 118,433,307 V47E possibly damaging Het
Other mutations in Frem2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Frem2 APN 3 53585595 missense probably damaging 1.00
IGL00911:Frem2 APN 3 53572462 missense probably damaging 1.00
IGL01322:Frem2 APN 3 53541038 missense probably benign 0.00
IGL01330:Frem2 APN 3 53655241 missense possibly damaging 0.70
IGL01406:Frem2 APN 3 53525896 missense probably damaging 1.00
IGL01556:Frem2 APN 3 53535281 missense probably benign 0.23
IGL01580:Frem2 APN 3 53655175 missense probably damaging 1.00
IGL01606:Frem2 APN 3 53653591 missense possibly damaging 0.69
IGL01611:Frem2 APN 3 53655709 missense probably benign 0.00
IGL01648:Frem2 APN 3 53535732 missense possibly damaging 0.86
IGL01663:Frem2 APN 3 53517013 missense probably damaging 1.00
IGL01665:Frem2 APN 3 53549662 missense probably benign 0.07
IGL01670:Frem2 APN 3 53656937 missense possibly damaging 0.95
IGL01960:Frem2 APN 3 53522304 missense probably benign 0.33
IGL02175:Frem2 APN 3 53655599 missense possibly damaging 0.69
IGL02201:Frem2 APN 3 53519640 missense probably benign 0.35
IGL02202:Frem2 APN 3 53654799 missense probably benign 0.00
IGL02427:Frem2 APN 3 53535763 missense probably damaging 0.97
IGL02457:Frem2 APN 3 53521049 missense probably damaging 0.99
IGL02638:Frem2 APN 3 53551346 missense possibly damaging 0.94
IGL02801:Frem2 APN 3 53652175 missense possibly damaging 0.85
IGL03023:Frem2 APN 3 53655628 missense probably benign 0.40
IGL03169:Frem2 APN 3 53522292 missense probably benign 0.01
IGL03238:Frem2 APN 3 53656261 missense possibly damaging 0.93
IGL03251:Frem2 APN 3 53572308 missense probably benign 0.01
IGL03273:Frem2 APN 3 53537509 nonsense probably null
IGL03343:Frem2 APN 3 53652253 missense probably damaging 1.00
Biosimilar UTSW 3 53654323 missense probably benign 0.01
Fruit_stripe UTSW 3 53537489 missense probably benign 0.21
PIT4366001:Frem2 UTSW 3 53653201 missense probably damaging 0.98
R0019:Frem2 UTSW 3 53523678 missense probably damaging 0.99
R0092:Frem2 UTSW 3 53589796 missense probably benign 0.03
R0108:Frem2 UTSW 3 53647961 missense probably benign 0.03
R0115:Frem2 UTSW 3 53656208 missense probably damaging 0.99
R0118:Frem2 UTSW 3 53535243 nonsense probably null
R0374:Frem2 UTSW 3 53653960 missense probably damaging 1.00
R0437:Frem2 UTSW 3 53653015 missense possibly damaging 0.96
R0531:Frem2 UTSW 3 53519954 missense probably damaging 1.00
R0555:Frem2 UTSW 3 53516860 missense probably damaging 0.97
R0564:Frem2 UTSW 3 53656109 missense probably damaging 0.97
R0586:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R0726:Frem2 UTSW 3 53519626 missense possibly damaging 0.89
R0925:Frem2 UTSW 3 53653973 missense probably benign
R1233:Frem2 UTSW 3 53547778 missense probably damaging 0.98
R1302:Frem2 UTSW 3 53655538 missense probably benign 0.00
R1333:Frem2 UTSW 3 53549731 missense probably benign 0.26
R1446:Frem2 UTSW 3 53654596 missense probably benign 0.31
R1523:Frem2 UTSW 3 53655407 missense possibly damaging 0.73
R1539:Frem2 UTSW 3 53654210 missense probably benign 0.19
R1543:Frem2 UTSW 3 53572455 missense possibly damaging 0.86
R1597:Frem2 UTSW 3 53654519 missense probably benign 0.19
R1600:Frem2 UTSW 3 53547723 missense probably damaging 1.00
R1678:Frem2 UTSW 3 53519938 missense probably damaging 1.00
R1687:Frem2 UTSW 3 53653952 missense probably benign
R1696:Frem2 UTSW 3 53656042 nonsense probably null
R1758:Frem2 UTSW 3 53653357 missense probably damaging 1.00
R1857:Frem2 UTSW 3 53654873 missense probably benign 0.10
R1869:Frem2 UTSW 3 53535196 missense probably benign 0.04
R1921:Frem2 UTSW 3 53653495 missense possibly damaging 0.76
R1973:Frem2 UTSW 3 53652232 missense probably benign 0.01
R2045:Frem2 UTSW 3 53535744 missense probably damaging 1.00
R2113:Frem2 UTSW 3 53652922 missense probably damaging 1.00
R2152:Frem2 UTSW 3 53517029 nonsense probably null
R2164:Frem2 UTSW 3 53537330 missense probably damaging 1.00
R2181:Frem2 UTSW 3 53574587 missense possibly damaging 0.72
R2201:Frem2 UTSW 3 53516573 missense probably benign
R2221:Frem2 UTSW 3 53516857 missense probably benign 0.00
R2255:Frem2 UTSW 3 53652514 missense probably damaging 0.96
R2280:Frem2 UTSW 3 53572423 missense probably damaging 1.00
R3196:Frem2 UTSW 3 53537331 missense probably damaging 1.00
R3716:Frem2 UTSW 3 53572360 missense probably damaging 1.00
R3807:Frem2 UTSW 3 53653449 missense probably benign 0.22
R3820:Frem2 UTSW 3 53516849 missense probably damaging 1.00
R3821:Frem2 UTSW 3 53652415 missense probably damaging 1.00
R3977:Frem2 UTSW 3 53652070 missense probably benign 0.00
R3979:Frem2 UTSW 3 53652070 missense probably benign 0.00
R4014:Frem2 UTSW 3 53652353 missense probably benign 0.01
R4127:Frem2 UTSW 3 53525896 missense probably damaging 1.00
R4195:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4196:Frem2 UTSW 3 53539268 missense possibly damaging 0.90
R4374:Frem2 UTSW 3 53545502 missense possibly damaging 0.61
R4427:Frem2 UTSW 3 53539162 critical splice donor site probably null
R4428:Frem2 UTSW 3 53654338 missense probably benign 0.40
R4559:Frem2 UTSW 3 53654321 missense probably benign 0.01
R4600:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4602:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4610:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4611:Frem2 UTSW 3 53547807 missense possibly damaging 0.96
R4678:Frem2 UTSW 3 53544371 missense probably benign 0.00
R4689:Frem2 UTSW 3 53547635 missense probably benign 0.43
R4740:Frem2 UTSW 3 53535819 missense probably benign 0.04
R4748:Frem2 UTSW 3 53541093 missense probably damaging 1.00
R4790:Frem2 UTSW 3 53516741 missense probably benign
R4809:Frem2 UTSW 3 53653895 missense probably benign 0.01
R4930:Frem2 UTSW 3 53656315 missense possibly damaging 0.93
R4971:Frem2 UTSW 3 53539183 missense probably damaging 1.00
R5057:Frem2 UTSW 3 53535196 missense probably benign 0.37
R5202:Frem2 UTSW 3 53551346 missense probably benign 0.41
R5221:Frem2 UTSW 3 53585611 missense probably damaging 1.00
R5231:Frem2 UTSW 3 53522295 missense probably damaging 1.00
R5268:Frem2 UTSW 3 53653154 missense probably damaging 0.96
R5480:Frem2 UTSW 3 53656507 nonsense probably null
R5637:Frem2 UTSW 3 53652937 missense probably damaging 0.97
R5664:Frem2 UTSW 3 53652490 missense probably benign 0.33
R5698:Frem2 UTSW 3 53652505 missense possibly damaging 0.89
R5744:Frem2 UTSW 3 53655959 missense probably damaging 1.00
R5754:Frem2 UTSW 3 53537258 missense probably damaging 1.00
R5808:Frem2 UTSW 3 53652563 missense probably damaging 0.96
R5840:Frem2 UTSW 3 53647921 missense probably damaging 0.99
R5874:Frem2 UTSW 3 53537489 missense probably benign 0.21
R6050:Frem2 UTSW 3 53653012 missense probably damaging 0.99
R6103:Frem2 UTSW 3 53549788 missense probably benign 0.00
R6149:Frem2 UTSW 3 53551341 missense probably damaging 0.98
R6182:Frem2 UTSW 3 53647969 missense probably damaging 1.00
R6191:Frem2 UTSW 3 53655280 missense probably benign 0.10
R6245:Frem2 UTSW 3 53655824 missense probably benign 0.00
R6252:Frem2 UTSW 3 53572448 missense probably damaging 1.00
R6393:Frem2 UTSW 3 53585640 missense possibly damaging 0.91
R6416:Frem2 UTSW 3 53572378 missense probably benign 0.01
R6595:Frem2 UTSW 3 53549784 missense probably damaging 1.00
R6665:Frem2 UTSW 3 53654656 missense probably damaging 1.00
R6708:Frem2 UTSW 3 53585501 missense probably benign 0.00
R6751:Frem2 UTSW 3 53653665 missense probably damaging 1.00
R6787:Frem2 UTSW 3 53654323 missense probably benign 0.01
R6913:Frem2 UTSW 3 53516821 missense probably damaging 1.00
R6916:Frem2 UTSW 3 53547688 missense probably damaging 1.00
R7017:Frem2 UTSW 3 53519602 missense probably benign 0.02
R7083:Frem2 UTSW 3 53537493 missense probably damaging 0.99
R7108:Frem2 UTSW 3 53653513 missense probably damaging 1.00
R7133:Frem2 UTSW 3 53572339 missense possibly damaging 0.82
R7326:Frem2 UTSW 3 53654753 missense probably damaging 1.00
R7341:Frem2 UTSW 3 53654495 missense probably damaging 1.00
R7455:Frem2 UTSW 3 53572280 splice site probably null
R7487:Frem2 UTSW 3 53654549 missense probably benign 0.40
R7495:Frem2 UTSW 3 53516837 missense probably benign 0.13
R7542:Frem2 UTSW 3 53652579 missense probably damaging 1.00
R7636:Frem2 UTSW 3 53653247 missense probably benign 0.00
R7703:Frem2 UTSW 3 53522168 missense probably benign 0.01
R7750:Frem2 UTSW 3 53523682 missense possibly damaging 0.83
R7849:Frem2 UTSW 3 53572374 missense probably damaging 1.00
R7932:Frem2 UTSW 3 53572374 missense probably damaging 1.00
R8008:Frem2 UTSW 3 53652910 missense probably damaging 1.00
R8051:Frem2 UTSW 3 53535355 missense probably benign 0.04
R8052:Frem2 UTSW 3 53549643 missense probably benign 0.02
Z1177:Frem2 UTSW 3 53535166 missense probably null 1.00
Z1177:Frem2 UTSW 3 53655607 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TAAAATGACCCTTGCTTCTGCC -3'
(R):5'- TTCTCCCAGTAGCGACTCTG -3'

Sequencing Primer
(F):5'- TCTTCCTGGGGGACATGC -3'
(R):5'- AGTAGCGACTCTGCTCCCAAG -3'
Posted On2015-10-08