Incidental Mutation 'R4661:Lrp6'
ID352841
Institutional Source Beutler Lab
Gene Symbol Lrp6
Ensembl Gene ENSMUSG00000030201
Gene Namelow density lipoprotein receptor-related protein 6
Synonymsskax26, Cd, ska26, ska
MMRRC Submission 041600-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.961) question?
Stock #R4661 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location134446476-134566965 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 134511267 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 289 (D289N)
Ref Sequence ENSEMBL: ENSMUSP00000032322 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032322] [ENSMUST00000126836]
Predicted Effect probably benign
Transcript: ENSMUST00000032322
AA Change: D289N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032322
Gene: ENSMUSG00000030201
AA Change: D289N

DomainStartEndE-ValueType
LY 43 85 1.55e-2 SMART
LY 87 129 1.91e-11 SMART
LY 130 173 5.19e-13 SMART
LY 174 216 1.39e-13 SMART
LY 217 258 2.87e-6 SMART
EGF 285 324 2.16e-1 SMART
low complexity region 330 341 N/A INTRINSIC
LY 352 394 1.29e-8 SMART
LY 395 437 5.73e-15 SMART
LY 438 481 1.07e-14 SMART
LY 482 524 3.07e-15 SMART
LY 525 565 4.66e-6 SMART
EGF 591 628 1.47e-3 SMART
LY 654 696 2.06e-7 SMART
LY 697 739 3.73e-14 SMART
LY 740 783 3.37e-12 SMART
LY 784 825 1.17e-6 SMART
LY 827 865 1.91e-2 SMART
EGF 892 930 7.35e-4 SMART
LY 957 999 1.41e-5 SMART
LY 1005 1048 5.32e-1 SMART
LY 1049 1093 5e-6 SMART
LY 1094 1136 4.25e-9 SMART
LY 1137 1177 1.91e-2 SMART
EGF 1206 1250 1.23e1 SMART
LDLa 1248 1287 2.42e-12 SMART
LDLa 1288 1324 4.37e-10 SMART
LDLa 1325 1362 1.66e-10 SMART
transmembrane domain 1371 1393 N/A INTRINSIC
low complexity region 1429 1438 N/A INTRINSIC
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1508 1524 N/A INTRINSIC
low complexity region 1566 1573 N/A INTRINSIC
low complexity region 1596 1608 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126836
SMART Domains Protein: ENSMUSP00000144733
Gene: ENSMUSG00000030201

DomainStartEndE-ValueType
LY 23 65 6.8e-16 SMART
LY 66 107 1.4e-8 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the low density lipoprotein (LDL) receptor gene family. LDL receptors are transmembrane cell surface proteins involved in receptor-mediated endocytosis of lipoprotein and protein ligands. The protein encoded by this gene functions as a receptor or, with Frizzled, a co-receptor for Wnt and thereby transmits the canonical Wnt/beta-catenin signaling cascade. Through its interaction with the Wnt/beta-catenin signaling cascade this gene plays a role in the regulation of cell differentiation, proliferation, and migration and the development of many cancer types. This protein undergoes gamma-secretase dependent RIP- (regulated intramembrane proteolysis) processing but the precise locations of the cleavage sites have not been determined.[provided by RefSeq, Dec 2009]
PHENOTYPE: Animals homozygous for this mutation exhibit partial embryonic lethality, growth retardation, crooked tail, abnormal vertebrae, small skull with occasional bent nose, absence of the third molars and small and/or unerupted lower incisors. Heterozygotes exhibit a crooked tail and abnormal vertebrae. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T C 9: 44,287,330 N42D probably damaging Het
Adamdec1 G A 14: 68,570,113 T366I probably damaging Het
Adamts7 C A 9: 90,193,330 H1038Q probably benign Het
Aff3 T C 1: 38,627,128 D5G possibly damaging Het
Amhr2 A T 15: 102,454,253 D485V probably damaging Het
Arhgap35 A T 7: 16,564,738 F134Y probably damaging Het
Asxl3 A G 18: 22,516,477 T508A probably benign Het
Atp10a TGGCGGCGGC TGGCGGC 7: 58,658,500 probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Atp9a A G 2: 168,637,672 F928L possibly damaging Het
BC034090 A T 1: 155,232,475 D13E probably damaging Het
Bco1 A G 8: 117,129,241 E425G probably benign Het
Brsk1 T C 7: 4,707,299 S436P possibly damaging Het
C1s1 T C 6: 124,536,490 I193V probably benign Het
Calb2 A G 8: 110,168,077 F21L probably benign Het
Catsperz T G 19: 6,924,803 T108P probably benign Het
Cep57l1 T A 10: 41,719,771 D329V possibly damaging Het
Cfdp1 A G 8: 111,830,945 F188S probably benign Het
Chrna2 G A 14: 66,148,843 G146D probably damaging Het
Col6a1 A C 10: 76,714,672 F520V unknown Het
Cyb5d2 C A 11: 72,778,945 V43L probably damaging Het
Cyp2c40 T C 19: 39,786,846 T321A probably benign Het
Dnajc16 A C 4: 141,763,548 Y764D probably damaging Het
Dsg1a G A 18: 20,340,533 V888M probably damaging Het
F5 A C 1: 164,184,920 T468P probably damaging Het
Faap24 A G 7: 35,395,084 M97T probably benign Het
Fam227b A T 2: 126,007,310 I334N probably damaging Het
Frem2 G T 3: 53,655,443 P548T probably damaging Het
Gfm1 A G 3: 67,433,398 E94G probably damaging Het
Gm17606 A T 14: 54,648,239 probably benign Het
Gnb2 A T 5: 137,530,253 M1K probably null Het
Gys1 G A 7: 45,454,834 A544T probably damaging Het
Hdac5 T C 11: 102,205,849 Y230C probably damaging Het
Hunk A T 16: 90,447,308 probably null Het
Ifnl2 A G 7: 28,510,210 F51L probably damaging Het
Itpr1 T C 6: 108,410,931 probably null Het
Kcnj1 A G 9: 32,396,622 Y114C probably benign Het
Kdm4b T A 17: 56,399,459 S322T probably damaging Het
Kif27 T C 13: 58,323,916 E786G probably damaging Het
Kif6 T C 17: 49,753,881 V414A probably benign Het
L1td1 A G 4: 98,733,624 K141R possibly damaging Het
Loxhd1 A G 18: 77,402,885 I1394V possibly damaging Het
Lrfn5 A T 12: 61,839,647 M74L probably damaging Het
Mroh7 A G 4: 106,691,513 probably null Het
Muc4 A C 16: 32,769,277 E2885A possibly damaging Het
Myo18b G T 5: 112,875,175 probably benign Het
Ncln G A 10: 81,493,068 A172V probably damaging Het
Nek9 G A 12: 85,320,892 T335M possibly damaging Het
Notch2 A G 3: 98,135,513 Y1398C probably damaging Het
Olfr472 A T 7: 107,902,981 H88L probably benign Het
Olfr710 T A 7: 106,944,867 I45F probably damaging Het
Olfr981 A T 9: 40,022,527 I45F probably damaging Het
Pax2 G A 19: 44,760,937 V40M probably damaging Het
Pde6c A G 19: 38,169,439 Y637C probably damaging Het
Plppr5 A G 3: 117,620,969 I80V probably damaging Het
Pold1 G T 7: 44,532,809 P1100T probably damaging Het
Prune2 T C 19: 17,000,023 Y41H probably damaging Het
Rgl2 C T 17: 33,933,226 A329V possibly damaging Het
Rilp T A 11: 75,511,424 Y250N probably damaging Het
Rilpl1 A G 5: 124,514,688 V19A probably benign Het
Rtp3 T C 9: 110,986,451 probably null Het
Rufy4 A G 1: 74,133,107 K246E probably damaging Het
Saraf C A 8: 34,168,462 A306E probably damaging Het
Slc26a8 A T 17: 28,638,684 N828K probably benign Het
Src C T 2: 157,469,932 P527S probably damaging Het
Susd3 C T 13: 49,231,302 probably null Het
Syngap1 T C 17: 26,966,906 L1270P probably damaging Het
Taf1c G A 8: 119,598,850 P758S probably damaging Het
Tenm2 A T 11: 36,024,448 N2087K probably damaging Het
Tfrc A T 16: 32,630,151 I703F probably damaging Het
Thap1 C G 8: 26,160,846 T48S probably benign Het
Tspear T C 10: 77,866,329 F199L probably benign Het
Usp17lc A T 7: 103,418,590 H364L probably benign Het
Usp9x A G X: 13,123,508 R776G possibly damaging Homo
Vmn1r1 T C 1: 182,157,224 E292G possibly damaging Het
Vmn1r125 T G 7: 21,272,627 V150G probably damaging Het
Vmn1r167 A T 7: 23,504,692 L300I probably damaging Het
Vmn2r106 A C 17: 20,267,623 I838S probably benign Het
Wdr64 A T 1: 175,726,494 S197C probably damaging Het
Zfp248 A T 6: 118,433,307 V47E possibly damaging Het
Other mutations in Lrp6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Lrp6 APN 6 134456090 missense probably benign 0.17
IGL00765:Lrp6 APN 6 134541854 missense probably benign 0.02
IGL00898:Lrp6 APN 6 134479739 missense probably damaging 0.99
IGL00916:Lrp6 APN 6 134484289 missense probably damaging 1.00
IGL00961:Lrp6 APN 6 134507646 missense probably damaging 0.98
IGL01620:Lrp6 APN 6 134511262 missense probably damaging 1.00
IGL01765:Lrp6 APN 6 134456145 missense probably damaging 0.99
IGL02066:Lrp6 APN 6 134450937 nonsense probably null
IGL02067:Lrp6 APN 6 134480396 missense probably damaging 0.99
IGL02169:Lrp6 APN 6 134513327 missense probably damaging 0.96
IGL02281:Lrp6 APN 6 134457734 missense probably benign 0.40
IGL02484:Lrp6 APN 6 134541923 missense probably benign 0.15
IGL02724:Lrp6 APN 6 134484265 missense probably damaging 1.00
IGL02876:Lrp6 APN 6 134456114 missense probably benign 0.43
IGL03011:Lrp6 APN 6 134520417 missense possibly damaging 0.80
IGL03352:Lrp6 APN 6 134479763 missense probably damaging 1.00
Coiled UTSW 6 134507558 nonsense probably null
PIT4494001:Lrp6 UTSW 6 134479778 missense probably damaging 1.00
R0008:Lrp6 UTSW 6 134485753 missense probably damaging 0.96
R0008:Lrp6 UTSW 6 134485753 missense probably damaging 0.96
R0201:Lrp6 UTSW 6 134450897 nonsense probably null
R0295:Lrp6 UTSW 6 134457693 missense probably benign 0.02
R0370:Lrp6 UTSW 6 134479766 missense probably damaging 1.00
R0382:Lrp6 UTSW 6 134467668 missense probably damaging 1.00
R0413:Lrp6 UTSW 6 134507624 missense probably damaging 0.99
R0468:Lrp6 UTSW 6 134485661 missense possibly damaging 0.94
R0492:Lrp6 UTSW 6 134480518 missense possibly damaging 0.58
R0584:Lrp6 UTSW 6 134456076 missense probably damaging 0.99
R0631:Lrp6 UTSW 6 134479775 missense possibly damaging 0.95
R0738:Lrp6 UTSW 6 134542045 missense probably benign 0.13
R0907:Lrp6 UTSW 6 134507525 missense probably damaging 0.96
R1273:Lrp6 UTSW 6 134467507 critical splice donor site probably null
R1548:Lrp6 UTSW 6 134459429 missense possibly damaging 0.89
R1639:Lrp6 UTSW 6 134453566 missense possibly damaging 0.68
R1650:Lrp6 UTSW 6 134468769 missense probably benign 0.01
R1696:Lrp6 UTSW 6 134468723 missense probably damaging 1.00
R1751:Lrp6 UTSW 6 134464568 missense probably damaging 1.00
R1780:Lrp6 UTSW 6 134464451 missense probably damaging 0.99
R2013:Lrp6 UTSW 6 134480374 critical splice donor site probably null
R2015:Lrp6 UTSW 6 134480374 critical splice donor site probably null
R2165:Lrp6 UTSW 6 134459283 missense probably damaging 1.00
R2294:Lrp6 UTSW 6 134457742 missense probably damaging 1.00
R2336:Lrp6 UTSW 6 134507583 missense probably damaging 0.97
R2964:Lrp6 UTSW 6 134467526 missense probably damaging 1.00
R3716:Lrp6 UTSW 6 134507447 missense probably damaging 1.00
R4017:Lrp6 UTSW 6 134520550 missense probably damaging 1.00
R4370:Lrp6 UTSW 6 134506358 nonsense probably null
R4521:Lrp6 UTSW 6 134485862 missense probably damaging 1.00
R4573:Lrp6 UTSW 6 134470730 nonsense probably null
R4645:Lrp6 UTSW 6 134484250 missense probably damaging 1.00
R4688:Lrp6 UTSW 6 134479743 missense probably damaging 1.00
R4784:Lrp6 UTSW 6 134479539 missense probably benign 0.06
R5236:Lrp6 UTSW 6 134511264 missense probably damaging 1.00
R5506:Lrp6 UTSW 6 134459296 missense probably benign 0.09
R5508:Lrp6 UTSW 6 134464516 missense probably benign 0.31
R6001:Lrp6 UTSW 6 134464518 missense probably benign 0.03
R6319:Lrp6 UTSW 6 134541835 missense possibly damaging 0.46
R6537:Lrp6 UTSW 6 134480495 missense probably benign
R6552:Lrp6 UTSW 6 134454729 missense probably benign 0.17
R6559:Lrp6 UTSW 6 134513254 missense probably damaging 1.00
R6575:Lrp6 UTSW 6 134541971 missense possibly damaging 0.80
R6585:Lrp6 UTSW 6 134507558 nonsense probably null
R6700:Lrp6 UTSW 6 134479560 missense probably damaging 1.00
R6724:Lrp6 UTSW 6 134486541 missense possibly damaging 0.94
R7159:Lrp6 UTSW 6 134507551 missense probably benign
R7266:Lrp6 UTSW 6 134507401 missense probably damaging 1.00
R7339:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7341:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7342:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7348:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7359:Lrp6 UTSW 6 134450960 nonsense probably null
R7366:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7368:Lrp6 UTSW 6 134450818 missense probably damaging 1.00
R7501:Lrp6 UTSW 6 134486508 missense probably damaging 1.00
R7548:Lrp6 UTSW 6 134507508 missense probably damaging 0.97
R7652:Lrp6 UTSW 6 134511245 nonsense probably null
R7771:Lrp6 UTSW 6 134462616 missense probably damaging 1.00
Z1176:Lrp6 UTSW 6 134456157 missense possibly damaging 0.72
Z1177:Lrp6 UTSW 6 134462541 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTAGCCTCCCAAAGTACTGC -3'
(R):5'- AGATGCTTGGTAGTCAAACACCTG -3'

Sequencing Primer
(F):5'- GTACTGCCAACTCTAGAGCTTAC -3'
(R):5'- GTCAAACACCTGGATGAAATTTGG -3'
Posted On2015-10-08