Incidental Mutation 'R4661:Arhgap35'
ID352843
Institutional Source Beutler Lab
Gene Symbol Arhgap35
Ensembl Gene ENSMUSG00000058230
Gene NameRho GTPase activating protein 35
Synonymsp190RhoGAP, p190A, Grlf1, P190 RhoGAP, 6430596G11Rik
MMRRC Submission 041600-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4661 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location16493719-16614993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16564738 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 134 (F134Y)
Ref Sequence ENSEMBL: ENSMUSP00000127379 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075845] [ENSMUST00000171937]
Predicted Effect probably damaging
Transcript: ENSMUST00000075845
AA Change: F134Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000075242
Gene: ENSMUSG00000058230
AA Change: F134Y

DomainStartEndE-ValueType
Pfam:Ras 154 249 6.1e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171937
AA Change: F134Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000127379
Gene: ENSMUSG00000058230
AA Change: F134Y

DomainStartEndE-ValueType
Pfam:Ras 154 249 6e-7 PFAM
FF 270 327 5.76e-9 SMART
FF 369 422 1.1e-5 SMART
FF 429 483 7.43e-12 SMART
FF 485 539 2.02e-4 SMART
Blast:RhoGAP 733 796 1e-7 BLAST
low complexity region 1037 1048 N/A INTRINSIC
low complexity region 1214 1225 N/A INTRINSIC
low complexity region 1227 1235 N/A INTRINSIC
RhoGAP 1259 1433 8.14e-72 SMART
low complexity region 1444 1457 N/A INTRINSIC
low complexity region 1462 1494 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The human glucocorticoid receptor DNA binding factor, which associates with the promoter region of the glucocorticoid receptor gene (hGR gene), is a repressor of glucocorticoid receptor transcription. The amino acid sequence deduced from the cDNA sequences show the presence of three sequence motifs characteristic of a zinc finger and one motif suggestive of a leucine zipper in which 1 cysteine is found instead of all leucines. The GRLF1 enhances the homologous down-regulation of wild-type hGR gene expression. Biochemical analysis suggests that GRLF1 interaction is sequence specific and that transcriptional efficacy of GRLF1 is regulated through its interaction with specific sequence motif. The level of expression is regulated by glucocorticoids. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene usually die within 2 days of birth and never survive beyond 3 weeks. Observed phenotypes include defects in eye morphogenesis, forebrain development, neural tube closure, axon guidance and fasciculation, and renal abnormalities, including hypoplastic and glomerulocystic kidneys, associated with a ciliogenesis defect. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T C 9: 44,287,330 N42D probably damaging Het
Adamdec1 G A 14: 68,570,113 T366I probably damaging Het
Adamts7 C A 9: 90,193,330 H1038Q probably benign Het
Aff3 T C 1: 38,627,128 D5G possibly damaging Het
Amhr2 A T 15: 102,454,253 D485V probably damaging Het
Asxl3 A G 18: 22,516,477 T508A probably benign Het
Atp10a TGGCGGCGGC TGGCGGC 7: 58,658,500 probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Atp9a A G 2: 168,637,672 F928L possibly damaging Het
BC034090 A T 1: 155,232,475 D13E probably damaging Het
Bco1 A G 8: 117,129,241 E425G probably benign Het
Brsk1 T C 7: 4,707,299 S436P possibly damaging Het
C1s1 T C 6: 124,536,490 I193V probably benign Het
Calb2 A G 8: 110,168,077 F21L probably benign Het
Catsperz T G 19: 6,924,803 T108P probably benign Het
Cep57l1 T A 10: 41,719,771 D329V possibly damaging Het
Cfdp1 A G 8: 111,830,945 F188S probably benign Het
Chrna2 G A 14: 66,148,843 G146D probably damaging Het
Col6a1 A C 10: 76,714,672 F520V unknown Het
Cyb5d2 C A 11: 72,778,945 V43L probably damaging Het
Cyp2c40 T C 19: 39,786,846 T321A probably benign Het
Dnajc16 A C 4: 141,763,548 Y764D probably damaging Het
Dsg1a G A 18: 20,340,533 V888M probably damaging Het
F5 A C 1: 164,184,920 T468P probably damaging Het
Faap24 A G 7: 35,395,084 M97T probably benign Het
Fam227b A T 2: 126,007,310 I334N probably damaging Het
Frem2 G T 3: 53,655,443 P548T probably damaging Het
Gfm1 A G 3: 67,433,398 E94G probably damaging Het
Gm17606 A T 14: 54,648,239 probably benign Het
Gnb2 A T 5: 137,530,253 M1K probably null Het
Gys1 G A 7: 45,454,834 A544T probably damaging Het
Hdac5 T C 11: 102,205,849 Y230C probably damaging Het
Hunk A T 16: 90,447,308 probably null Het
Ifnl2 A G 7: 28,510,210 F51L probably damaging Het
Itpr1 T C 6: 108,410,931 probably null Het
Kcnj1 A G 9: 32,396,622 Y114C probably benign Het
Kdm4b T A 17: 56,399,459 S322T probably damaging Het
Kif27 T C 13: 58,323,916 E786G probably damaging Het
Kif6 T C 17: 49,753,881 V414A probably benign Het
L1td1 A G 4: 98,733,624 K141R possibly damaging Het
Loxhd1 A G 18: 77,402,885 I1394V possibly damaging Het
Lrfn5 A T 12: 61,839,647 M74L probably damaging Het
Lrp6 C T 6: 134,511,267 D289N probably benign Het
Mroh7 A G 4: 106,691,513 probably null Het
Muc4 A C 16: 32,769,277 E2885A possibly damaging Het
Myo18b G T 5: 112,875,175 probably benign Het
Ncln G A 10: 81,493,068 A172V probably damaging Het
Nek9 G A 12: 85,320,892 T335M possibly damaging Het
Notch2 A G 3: 98,135,513 Y1398C probably damaging Het
Olfr472 A T 7: 107,902,981 H88L probably benign Het
Olfr710 T A 7: 106,944,867 I45F probably damaging Het
Olfr981 A T 9: 40,022,527 I45F probably damaging Het
Pax2 G A 19: 44,760,937 V40M probably damaging Het
Pde6c A G 19: 38,169,439 Y637C probably damaging Het
Plppr5 A G 3: 117,620,969 I80V probably damaging Het
Pold1 G T 7: 44,532,809 P1100T probably damaging Het
Prune2 T C 19: 17,000,023 Y41H probably damaging Het
Rgl2 C T 17: 33,933,226 A329V possibly damaging Het
Rilp T A 11: 75,511,424 Y250N probably damaging Het
Rilpl1 A G 5: 124,514,688 V19A probably benign Het
Rtp3 T C 9: 110,986,451 probably null Het
Rufy4 A G 1: 74,133,107 K246E probably damaging Het
Saraf C A 8: 34,168,462 A306E probably damaging Het
Slc26a8 A T 17: 28,638,684 N828K probably benign Het
Src C T 2: 157,469,932 P527S probably damaging Het
Susd3 C T 13: 49,231,302 probably null Het
Syngap1 T C 17: 26,966,906 L1270P probably damaging Het
Taf1c G A 8: 119,598,850 P758S probably damaging Het
Tenm2 A T 11: 36,024,448 N2087K probably damaging Het
Tfrc A T 16: 32,630,151 I703F probably damaging Het
Thap1 C G 8: 26,160,846 T48S probably benign Het
Tspear T C 10: 77,866,329 F199L probably benign Het
Usp17lc A T 7: 103,418,590 H364L probably benign Het
Usp9x A G X: 13,123,508 R776G possibly damaging Homo
Vmn1r1 T C 1: 182,157,224 E292G possibly damaging Het
Vmn1r125 T G 7: 21,272,627 V150G probably damaging Het
Vmn1r167 A T 7: 23,504,692 L300I probably damaging Het
Vmn2r106 A C 17: 20,267,623 I838S probably benign Het
Wdr64 A T 1: 175,726,494 S197C probably damaging Het
Zfp248 A T 6: 118,433,307 V47E possibly damaging Het
Other mutations in Arhgap35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Arhgap35 APN 7 16564415 missense probably benign 0.03
IGL00684:Arhgap35 APN 7 16561700 missense possibly damaging 0.93
IGL01385:Arhgap35 APN 7 16564474 missense probably damaging 0.96
IGL01411:Arhgap35 APN 7 16564267 missense probably benign
IGL01922:Arhgap35 APN 7 16564255 missense possibly damaging 0.73
IGL01977:Arhgap35 APN 7 16563203 missense probably damaging 1.00
IGL02074:Arhgap35 APN 7 16563055 missense probably benign 0.19
IGL02305:Arhgap35 APN 7 16563665 missense probably benign 0.15
IGL02342:Arhgap35 APN 7 16562380 missense probably benign 0.12
IGL02973:Arhgap35 APN 7 16562878 missense possibly damaging 0.50
IGL02989:Arhgap35 APN 7 16497655 makesense probably null
PIT4382001:Arhgap35 UTSW 7 16563869 missense possibly damaging 0.95
PIT4431001:Arhgap35 UTSW 7 16561611 missense possibly damaging 0.87
R0047:Arhgap35 UTSW 7 16561992 missense probably benign 0.17
R1690:Arhgap35 UTSW 7 16563281 missense probably damaging 1.00
R1820:Arhgap35 UTSW 7 16561949 missense possibly damaging 0.92
R2036:Arhgap35 UTSW 7 16563133 missense probably damaging 1.00
R2205:Arhgap35 UTSW 7 16498025 splice site probably null
R2292:Arhgap35 UTSW 7 16563551 missense probably damaging 1.00
R3079:Arhgap35 UTSW 7 16562576 missense probably damaging 1.00
R3745:Arhgap35 UTSW 7 16563722 missense probably damaging 1.00
R3762:Arhgap35 UTSW 7 16565075 missense probably damaging 0.98
R4709:Arhgap35 UTSW 7 16563586 missense probably damaging 0.97
R4749:Arhgap35 UTSW 7 16498626 missense possibly damaging 0.95
R5081:Arhgap35 UTSW 7 16565134 missense possibly damaging 0.71
R5131:Arhgap35 UTSW 7 16511187 splice site probably null
R5175:Arhgap35 UTSW 7 16562599 missense probably damaging 1.00
R5440:Arhgap35 UTSW 7 16562924 missense probably damaging 1.00
R5517:Arhgap35 UTSW 7 16563489 missense probably damaging 1.00
R5987:Arhgap35 UTSW 7 16563467 missense possibly damaging 0.84
R6087:Arhgap35 UTSW 7 16563643 missense probably damaging 1.00
R6139:Arhgap35 UTSW 7 16563467 missense possibly damaging 0.84
R6396:Arhgap35 UTSW 7 16562299 missense probably damaging 0.99
R6878:Arhgap35 UTSW 7 16565113 missense probably benign 0.00
R7063:Arhgap35 UTSW 7 16565113 missense probably benign 0.00
R7150:Arhgap35 UTSW 7 16562566 missense probably damaging 0.96
R7269:Arhgap35 UTSW 7 16561727 missense probably benign
R7276:Arhgap35 UTSW 7 16564568 missense probably damaging 1.00
R7517:Arhgap35 UTSW 7 16562207 missense probably benign 0.31
R7593:Arhgap35 UTSW 7 16564861 missense probably damaging 1.00
R7775:Arhgap35 UTSW 7 16562648 missense probably benign 0.01
R7792:Arhgap35 UTSW 7 16561528 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CCTCATCACACTTAGTCAGGAC -3'
(R):5'- GACCACTTTCTGTACTGGGG -3'

Sequencing Primer
(F):5'- CTTAGTCAGGACTACCACTATGGG -3'
(R):5'- ACCACTTTCTGTACTGGGGAGAAG -3'
Posted On2015-10-08