Incidental Mutation 'R4661:Gys1'
ID352850
Institutional Source Beutler Lab
Gene Symbol Gys1
Ensembl Gene ENSMUSG00000003865
Gene Nameglycogen synthase 1, muscle
SynonymsGys3, MGS
MMRRC Submission 041600-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4661 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45434844-45456619 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 45454834 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 544 (A544T)
Ref Sequence ENSEMBL: ENSMUSP00000148252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003964] [ENSMUST00000094434] [ENSMUST00000210106] [ENSMUST00000210864] [ENSMUST00000211150]
Predicted Effect probably damaging
Transcript: ENSMUST00000003964
AA Change: A608T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003964
Gene: ENSMUSG00000003865
AA Change: A608T

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:Glyco_transf_5 28 274 5.2e-8 PFAM
Pfam:Glycogen_syn 31 663 N/A PFAM
low complexity region 670 686 N/A INTRINSIC
low complexity region 698 711 N/A INTRINSIC
low complexity region 716 733 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000094434
SMART Domains Protein: ENSMUSP00000092002
Gene: ENSMUSG00000050708

DomainStartEndE-ValueType
Pfam:Ferritin 14 155 4.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000102082
Predicted Effect probably damaging
Transcript: ENSMUST00000107766
AA Change: A544T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103395
Gene: ENSMUSG00000003865
AA Change: A544T

DomainStartEndE-ValueType
low complexity region 3 12 N/A INTRINSIC
Pfam:Glycogen_syn 31 105 2.3e-29 PFAM
Pfam:Glycogen_syn 99 599 1.2e-298 PFAM
Pfam:Glycos_transf_1 422 482 5e-6 PFAM
low complexity region 606 622 N/A INTRINSIC
low complexity region 634 647 N/A INTRINSIC
low complexity region 652 669 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209230
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209541
Predicted Effect unknown
Transcript: ENSMUST00000209640
AA Change: A133T
Predicted Effect probably benign
Transcript: ENSMUST00000210106
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210375
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210563
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210715
Predicted Effect probably benign
Transcript: ENSMUST00000210864
Predicted Effect probably damaging
Transcript: ENSMUST00000211150
AA Change: A544T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211694
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211500
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the addition of glucose monomers to the growing glycogen molecule through the formation of alpha-1,4-glycoside linkages. Mutations in this gene are associated with muscle glycogen storage disease. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mice display neonatal lethality due to impaired cardiac function and exhibit reduced reduced ventricular chamber size, dilated atria, vascular congestion, and liver hemorrhage. Mice homozygous for a knock-in allele show altered glycogen homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T C 9: 44,287,330 N42D probably damaging Het
Adamdec1 G A 14: 68,570,113 T366I probably damaging Het
Adamts7 C A 9: 90,193,330 H1038Q probably benign Het
Aff3 T C 1: 38,627,128 D5G possibly damaging Het
Amhr2 A T 15: 102,454,253 D485V probably damaging Het
Arhgap35 A T 7: 16,564,738 F134Y probably damaging Het
Asxl3 A G 18: 22,516,477 T508A probably benign Het
Atp10a TGGCGGCGGC TGGCGGC 7: 58,658,500 probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Atp9a A G 2: 168,637,672 F928L possibly damaging Het
BC034090 A T 1: 155,232,475 D13E probably damaging Het
Bco1 A G 8: 117,129,241 E425G probably benign Het
Brsk1 T C 7: 4,707,299 S436P possibly damaging Het
C1s1 T C 6: 124,536,490 I193V probably benign Het
Calb2 A G 8: 110,168,077 F21L probably benign Het
Catsperz T G 19: 6,924,803 T108P probably benign Het
Cep57l1 T A 10: 41,719,771 D329V possibly damaging Het
Cfdp1 A G 8: 111,830,945 F188S probably benign Het
Chrna2 G A 14: 66,148,843 G146D probably damaging Het
Col6a1 A C 10: 76,714,672 F520V unknown Het
Cyb5d2 C A 11: 72,778,945 V43L probably damaging Het
Cyp2c40 T C 19: 39,786,846 T321A probably benign Het
Dnajc16 A C 4: 141,763,548 Y764D probably damaging Het
Dsg1a G A 18: 20,340,533 V888M probably damaging Het
F5 A C 1: 164,184,920 T468P probably damaging Het
Faap24 A G 7: 35,395,084 M97T probably benign Het
Fam227b A T 2: 126,007,310 I334N probably damaging Het
Frem2 G T 3: 53,655,443 P548T probably damaging Het
Gfm1 A G 3: 67,433,398 E94G probably damaging Het
Gm17606 A T 14: 54,648,239 probably benign Het
Gnb2 A T 5: 137,530,253 M1K probably null Het
Hdac5 T C 11: 102,205,849 Y230C probably damaging Het
Hunk A T 16: 90,447,308 probably null Het
Ifnl2 A G 7: 28,510,210 F51L probably damaging Het
Itpr1 T C 6: 108,410,931 probably null Het
Kcnj1 A G 9: 32,396,622 Y114C probably benign Het
Kdm4b T A 17: 56,399,459 S322T probably damaging Het
Kif27 T C 13: 58,323,916 E786G probably damaging Het
Kif6 T C 17: 49,753,881 V414A probably benign Het
L1td1 A G 4: 98,733,624 K141R possibly damaging Het
Loxhd1 A G 18: 77,402,885 I1394V possibly damaging Het
Lrfn5 A T 12: 61,839,647 M74L probably damaging Het
Lrp6 C T 6: 134,511,267 D289N probably benign Het
Mroh7 A G 4: 106,691,513 probably null Het
Muc4 A C 16: 32,769,277 E2885A possibly damaging Het
Myo18b G T 5: 112,875,175 probably benign Het
Ncln G A 10: 81,493,068 A172V probably damaging Het
Nek9 G A 12: 85,320,892 T335M possibly damaging Het
Notch2 A G 3: 98,135,513 Y1398C probably damaging Het
Olfr472 A T 7: 107,902,981 H88L probably benign Het
Olfr710 T A 7: 106,944,867 I45F probably damaging Het
Olfr981 A T 9: 40,022,527 I45F probably damaging Het
Pax2 G A 19: 44,760,937 V40M probably damaging Het
Pde6c A G 19: 38,169,439 Y637C probably damaging Het
Plppr5 A G 3: 117,620,969 I80V probably damaging Het
Pold1 G T 7: 44,532,809 P1100T probably damaging Het
Prune2 T C 19: 17,000,023 Y41H probably damaging Het
Rgl2 C T 17: 33,933,226 A329V possibly damaging Het
Rilp T A 11: 75,511,424 Y250N probably damaging Het
Rilpl1 A G 5: 124,514,688 V19A probably benign Het
Rtp3 T C 9: 110,986,451 probably null Het
Rufy4 A G 1: 74,133,107 K246E probably damaging Het
Saraf C A 8: 34,168,462 A306E probably damaging Het
Slc26a8 A T 17: 28,638,684 N828K probably benign Het
Src C T 2: 157,469,932 P527S probably damaging Het
Susd3 C T 13: 49,231,302 probably null Het
Syngap1 T C 17: 26,966,906 L1270P probably damaging Het
Taf1c G A 8: 119,598,850 P758S probably damaging Het
Tenm2 A T 11: 36,024,448 N2087K probably damaging Het
Tfrc A T 16: 32,630,151 I703F probably damaging Het
Thap1 C G 8: 26,160,846 T48S probably benign Het
Tspear T C 10: 77,866,329 F199L probably benign Het
Usp17lc A T 7: 103,418,590 H364L probably benign Het
Usp9x A G X: 13,123,508 R776G possibly damaging Homo
Vmn1r1 T C 1: 182,157,224 E292G possibly damaging Het
Vmn1r125 T G 7: 21,272,627 V150G probably damaging Het
Vmn1r167 A T 7: 23,504,692 L300I probably damaging Het
Vmn2r106 A C 17: 20,267,623 I838S probably benign Het
Wdr64 A T 1: 175,726,494 S197C probably damaging Het
Zfp248 A T 6: 118,433,307 V47E possibly damaging Het
Other mutations in Gys1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Gys1 APN 7 45444832 missense possibly damaging 0.88
IGL00870:Gys1 APN 7 45448013 critical splice donor site probably null
IGL01346:Gys1 APN 7 45442537 missense probably damaging 1.00
IGL02396:Gys1 APN 7 45439588 missense probably damaging 1.00
IGL03157:Gys1 APN 7 45439899 unclassified probably benign
IGL03196:Gys1 APN 7 45454817 splice site probably benign
R0095:Gys1 UTSW 7 45444649 missense possibly damaging 0.87
R0284:Gys1 UTSW 7 45436719 unclassified probably benign
R0537:Gys1 UTSW 7 45440001 missense probably damaging 1.00
R0622:Gys1 UTSW 7 45439995 missense probably damaging 1.00
R1749:Gys1 UTSW 7 45440032 missense probably damaging 1.00
R1968:Gys1 UTSW 7 45443546 missense probably damaging 1.00
R3953:Gys1 UTSW 7 45440046 missense probably damaging 1.00
R4058:Gys1 UTSW 7 45448386 splice site probably benign
R4626:Gys1 UTSW 7 45439534 missense probably damaging 1.00
R4998:Gys1 UTSW 7 45451544 intron probably benign
R5965:Gys1 UTSW 7 45455339 missense probably benign 0.25
R5987:Gys1 UTSW 7 45438105 missense probably benign 0.00
R6059:Gys1 UTSW 7 45455288 utr 3 prime probably null
R6481:Gys1 UTSW 7 45442969 missense possibly damaging 0.63
R6788:Gys1 UTSW 7 45444678 missense probably damaging 0.99
R6924:Gys1 UTSW 7 45443635 critical splice donor site probably null
R7006:Gys1 UTSW 7 45440013 missense probably damaging 1.00
R7029:Gys1 UTSW 7 45439584 missense possibly damaging 0.93
R7060:Gys1 UTSW 7 45440013 missense probably damaging 1.00
R7211:Gys1 UTSW 7 45448260 missense possibly damaging 0.88
R7237:Gys1 UTSW 7 45455162 missense probably benign 0.02
R7242:Gys1 UTSW 7 45439668 splice site probably null
R7593:Gys1 UTSW 7 45442936 missense probably damaging 0.99
R7641:Gys1 UTSW 7 45455071 missense probably damaging 0.98
R7674:Gys1 UTSW 7 45455071 missense probably damaging 0.98
R7756:Gys1 UTSW 7 45448302 missense probably benign 0.43
R8197:Gys1 UTSW 7 45442924 missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- ACCAAGTGAAGATTGCTGGG -3'
(R):5'- GGTGCCATTTAAGTCCCTAGAG -3'

Sequencing Primer
(F):5'- TCGTGTCCACCAGTAATGAGG -3'
(R):5'- AGTCCCTAGAGGTGTCCACTAACTG -3'
Posted On2015-10-08