Incidental Mutation 'R4661:Bco1'
ID352859
Institutional Source Beutler Lab
Gene Symbol Bco1
Ensembl Gene ENSMUSG00000031845
Gene Namebeta-carotene oxygenase 1
SynonymsBcdo1, betaCMOOX, Bcmo1, Bcdo, beta-CD, Cmoi
MMRRC Submission 041600-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.205) question?
Stock #R4661 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location117095854-117133720 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 117129241 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 425 (E425G)
Ref Sequence ENSEMBL: ENSMUSP00000134815 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034308] [ENSMUST00000167370] [ENSMUST00000176860]
Predicted Effect probably benign
Transcript: ENSMUST00000034308
AA Change: E425G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000034308
Gene: ENSMUSG00000031845
AA Change: E425G

DomainStartEndE-ValueType
Pfam:RPE65 5 519 9e-114 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167370
AA Change: E425G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000132042
Gene: ENSMUSG00000031845
AA Change: E425G

DomainStartEndE-ValueType
Pfam:RPE65 2 472 4.9e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176860
AA Change: E425G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000134815
Gene: ENSMUSG00000031845
AA Change: E425G

DomainStartEndE-ValueType
Pfam:RPE65 2 472 4.9e-117 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176943
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: Vitamin A metabolism is important for vital processes such as vision, embryonic development, cell differentiation, and membrane and skin protection. The protein encoded by this gene is a key enzyme in beta-carotene metabolism to vitamin A. It catalyzes the oxidative cleavage of beta,beta-carotene into two retinal molecules. Two alternatively spliced variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009]
PHENOTYPE: Mice homozygous for a null mutation display fatty livers, elevated serum free fatty acid levels, increased susceptibility to diet-induced obesity, and impaired conversion of beta-carotene to vitamin A. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T C 9: 44,287,330 N42D probably damaging Het
Adamdec1 G A 14: 68,570,113 T366I probably damaging Het
Adamts7 C A 9: 90,193,330 H1038Q probably benign Het
Aff3 T C 1: 38,627,128 D5G possibly damaging Het
Amhr2 A T 15: 102,454,253 D485V probably damaging Het
Arhgap35 A T 7: 16,564,738 F134Y probably damaging Het
Asxl3 A G 18: 22,516,477 T508A probably benign Het
Atp10a TGGCGGCGGC TGGCGGC 7: 58,658,500 probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Atp9a A G 2: 168,637,672 F928L possibly damaging Het
BC034090 A T 1: 155,232,475 D13E probably damaging Het
Brsk1 T C 7: 4,707,299 S436P possibly damaging Het
C1s1 T C 6: 124,536,490 I193V probably benign Het
Calb2 A G 8: 110,168,077 F21L probably benign Het
Catsperz T G 19: 6,924,803 T108P probably benign Het
Cep57l1 T A 10: 41,719,771 D329V possibly damaging Het
Cfdp1 A G 8: 111,830,945 F188S probably benign Het
Chrna2 G A 14: 66,148,843 G146D probably damaging Het
Col6a1 A C 10: 76,714,672 F520V unknown Het
Cyb5d2 C A 11: 72,778,945 V43L probably damaging Het
Cyp2c40 T C 19: 39,786,846 T321A probably benign Het
Dnajc16 A C 4: 141,763,548 Y764D probably damaging Het
Dsg1a G A 18: 20,340,533 V888M probably damaging Het
F5 A C 1: 164,184,920 T468P probably damaging Het
Faap24 A G 7: 35,395,084 M97T probably benign Het
Fam227b A T 2: 126,007,310 I334N probably damaging Het
Frem2 G T 3: 53,655,443 P548T probably damaging Het
Gfm1 A G 3: 67,433,398 E94G probably damaging Het
Gm17606 A T 14: 54,648,239 probably benign Het
Gnb2 A T 5: 137,530,253 M1K probably null Het
Gys1 G A 7: 45,454,834 A544T probably damaging Het
Hdac5 T C 11: 102,205,849 Y230C probably damaging Het
Hunk A T 16: 90,447,308 probably null Het
Ifnl2 A G 7: 28,510,210 F51L probably damaging Het
Itpr1 T C 6: 108,410,931 probably null Het
Kcnj1 A G 9: 32,396,622 Y114C probably benign Het
Kdm4b T A 17: 56,399,459 S322T probably damaging Het
Kif27 T C 13: 58,323,916 E786G probably damaging Het
Kif6 T C 17: 49,753,881 V414A probably benign Het
L1td1 A G 4: 98,733,624 K141R possibly damaging Het
Loxhd1 A G 18: 77,402,885 I1394V possibly damaging Het
Lrfn5 A T 12: 61,839,647 M74L probably damaging Het
Lrp6 C T 6: 134,511,267 D289N probably benign Het
Mroh7 A G 4: 106,691,513 probably null Het
Muc4 A C 16: 32,769,277 E2885A possibly damaging Het
Myo18b G T 5: 112,875,175 probably benign Het
Ncln G A 10: 81,493,068 A172V probably damaging Het
Nek9 G A 12: 85,320,892 T335M possibly damaging Het
Notch2 A G 3: 98,135,513 Y1398C probably damaging Het
Olfr472 A T 7: 107,902,981 H88L probably benign Het
Olfr710 T A 7: 106,944,867 I45F probably damaging Het
Olfr981 A T 9: 40,022,527 I45F probably damaging Het
Pax2 G A 19: 44,760,937 V40M probably damaging Het
Pde6c A G 19: 38,169,439 Y637C probably damaging Het
Plppr5 A G 3: 117,620,969 I80V probably damaging Het
Pold1 G T 7: 44,532,809 P1100T probably damaging Het
Prune2 T C 19: 17,000,023 Y41H probably damaging Het
Rgl2 C T 17: 33,933,226 A329V possibly damaging Het
Rilp T A 11: 75,511,424 Y250N probably damaging Het
Rilpl1 A G 5: 124,514,688 V19A probably benign Het
Rtp3 T C 9: 110,986,451 probably null Het
Rufy4 A G 1: 74,133,107 K246E probably damaging Het
Saraf C A 8: 34,168,462 A306E probably damaging Het
Slc26a8 A T 17: 28,638,684 N828K probably benign Het
Src C T 2: 157,469,932 P527S probably damaging Het
Susd3 C T 13: 49,231,302 probably null Het
Syngap1 T C 17: 26,966,906 L1270P probably damaging Het
Taf1c G A 8: 119,598,850 P758S probably damaging Het
Tenm2 A T 11: 36,024,448 N2087K probably damaging Het
Tfrc A T 16: 32,630,151 I703F probably damaging Het
Thap1 C G 8: 26,160,846 T48S probably benign Het
Tspear T C 10: 77,866,329 F199L probably benign Het
Usp17lc A T 7: 103,418,590 H364L probably benign Het
Usp9x A G X: 13,123,508 R776G possibly damaging Homo
Vmn1r1 T C 1: 182,157,224 E292G possibly damaging Het
Vmn1r125 T G 7: 21,272,627 V150G probably damaging Het
Vmn1r167 A T 7: 23,504,692 L300I probably damaging Het
Vmn2r106 A C 17: 20,267,623 I838S probably benign Het
Wdr64 A T 1: 175,726,494 S197C probably damaging Het
Zfp248 A T 6: 118,433,307 V47E possibly damaging Het
Other mutations in Bco1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Bco1 APN 8 117130637 missense probably damaging 1.00
IGL01934:Bco1 APN 8 117096045 missense possibly damaging 0.90
IGL02182:Bco1 APN 8 117133066 missense probably damaging 1.00
IGL02375:Bco1 APN 8 117113439 missense probably benign 0.13
IGL02705:Bco1 APN 8 117117503 missense possibly damaging 0.95
H8562:Bco1 UTSW 8 117105647 splice site probably benign
R0453:Bco1 UTSW 8 117108777 missense possibly damaging 0.55
R0652:Bco1 UTSW 8 117105696 missense probably damaging 1.00
R1619:Bco1 UTSW 8 117108715 missense probably damaging 1.00
R1772:Bco1 UTSW 8 117130608 missense probably benign 0.03
R1827:Bco1 UTSW 8 117105759 missense probably damaging 1.00
R1834:Bco1 UTSW 8 117117437 missense probably benign 0.01
R2261:Bco1 UTSW 8 117133025 missense probably damaging 1.00
R2262:Bco1 UTSW 8 117133025 missense probably damaging 1.00
R2273:Bco1 UTSW 8 117108783 critical splice donor site probably null
R2274:Bco1 UTSW 8 117108783 critical splice donor site probably null
R3037:Bco1 UTSW 8 117127539 missense probably benign 0.00
R3792:Bco1 UTSW 8 117130676 missense possibly damaging 0.95
R3926:Bco1 UTSW 8 117127472 missense probably benign
R4193:Bco1 UTSW 8 117113469 missense probably damaging 1.00
R4968:Bco1 UTSW 8 117131094 missense probably benign 0.00
R5277:Bco1 UTSW 8 117117389 splice site probably null
R5523:Bco1 UTSW 8 117108693 missense possibly damaging 0.67
R6006:Bco1 UTSW 8 117113591 splice site probably null
R6174:Bco1 UTSW 8 117113534 missense probably damaging 0.97
R6458:Bco1 UTSW 8 117127506 missense possibly damaging 0.50
R6815:Bco1 UTSW 8 117113522 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTGGGTCTGAATCAAGGCTAG -3'
(R):5'- AGGGCTCCCTAAGTGCAAAC -3'

Sequencing Primer
(F):5'- CTGAATCAAGGCTAGGATAGTACTTG -3'
(R):5'- AGGAACAGAACTCTTACTTCAGG -3'
Posted On2015-10-08