Incidental Mutation 'R0271:Serpini2'
ID35286
Institutional Source Beutler Lab
Gene Symbol Serpini2
Ensembl Gene ENSMUSG00000034139
Gene Nameserine (or cysteine) peptidase inhibitor, clade I, member 2
Synonyms1810006A24Rik
MMRRC Submission 038497-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R0271 (G1)
Quality Score135
Status Validated
Chromosome3
Chromosomal Location75242370-75270078 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75246578 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 358 (M358T)
Ref Sequence ENSEMBL: ENSMUSP00000046943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039047]
Predicted Effect probably damaging
Transcript: ENSMUST00000039047
AA Change: M358T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046943
Gene: ENSMUSG00000034139
AA Change: M358T

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SERPIN 31 392 8.75e-130 SMART
Meta Mutation Damage Score 0.1510 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene encodes a member of a family of proteins that acts as inhibitors of serine proteases. These proteins function in the regulation of a variety of physiological processes, including coagulation, fibrinolysis, development, malignancy, and inflammation. Expression of the encoded protein may be downregulated during pancreatic carcinogenesis. Alternative splicing results in multiple transcript variants for this gene. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a transgene insertion/deletion encompassing this gene display pancreatic insufficiency characterized by progressive apoptosis of pancreatic acinar cells, postnatal growth retardation, immunological anomalies, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,686,329 probably benign Het
4930544D05Rik A G 11: 70,616,648 Q173R possibly damaging Het
Ampd2 C T 3: 108,086,716 probably benign Het
Ankrd17 T C 5: 90,254,799 S1467G possibly damaging Het
Arhgap31 T G 16: 38,602,510 S1065R possibly damaging Het
Arhgef19 G T 4: 141,250,607 M542I probably benign Het
C7 T C 15: 5,015,380 D392G possibly damaging Het
Ccdc138 G A 10: 58,575,823 C671Y probably damaging Het
Cdh8 A G 8: 99,111,715 S498P possibly damaging Het
Cpb2 T A 14: 75,257,709 probably null Het
Cwc22 A C 2: 77,920,858 N389K probably benign Het
Dgkb T A 12: 38,228,026 L550Q probably damaging Het
Dip2c A G 13: 9,615,775 R950G probably damaging Het
Eml6 A G 11: 29,848,949 V437A possibly damaging Het
Fanca T C 8: 123,272,441 probably benign Het
Fgd2 C G 17: 29,367,008 L189V possibly damaging Het
Foxred2 A C 15: 77,943,390 S590A possibly damaging Het
Gm1110 A G 9: 26,920,666 F63S probably damaging Het
Gm14496 A T 2: 181,995,954 M274L probably benign Het
Gm7008 T A 12: 40,223,560 probably benign Het
Gm9922 T A 14: 101,729,553 probably benign Het
Gtf3c3 A T 1: 54,428,812 M222K possibly damaging Het
Hspa1b A G 17: 34,958,832 V59A probably benign Het
Impg1 T C 9: 80,386,879 probably benign Het
Lpcat4 T A 2: 112,243,245 probably null Het
Mipol1 T C 12: 57,460,954 probably benign Het
Mrpl37 C A 4: 107,066,461 R112L possibly damaging Het
Myo18b T C 5: 112,809,685 N1471D possibly damaging Het
Nes G A 3: 87,978,642 E1359K possibly damaging Het
Nipbl A T 15: 8,361,737 V251E possibly damaging Het
Nlrp1b T C 11: 71,161,765 I946V possibly damaging Het
Obscn T G 11: 59,056,742 probably benign Het
Olfr1024 A T 2: 85,904,289 M255K possibly damaging Het
Olfr1239 T A 2: 89,418,158 Y85F probably benign Het
Olfr1491 A T 19: 13,705,135 T103S probably benign Het
Olfr635 T A 7: 103,979,630 I146K possibly damaging Het
Pck2 T C 14: 55,544,584 probably null Het
Pcsk9 A G 4: 106,449,049 probably benign Het
Phyhd1 A T 2: 30,269,822 Q56L probably benign Het
Plxnc1 C T 10: 94,837,918 G1001S probably null Het
Prss52 T C 14: 64,113,678 V304A probably benign Het
Prss55 C T 14: 64,075,607 G276D probably benign Het
Pzp A T 6: 128,519,514 Y252N probably damaging Het
Rad1 T C 15: 10,490,457 probably null Het
Ripply3 A T 16: 94,335,757 E92D possibly damaging Het
Rpp30 T A 19: 36,104,403 D255E probably benign Het
Rsad1 T C 11: 94,548,464 probably benign Het
Slc35a1 T A 4: 34,664,125 E331V probably benign Het
Slc38a7 A G 8: 95,845,878 F179L probably damaging Het
Stmn4 C T 14: 66,356,283 Q42* probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tab2 G A 10: 7,919,158 A520V probably benign Het
Tcp10a A G 17: 7,331,156 I162M probably benign Het
Tmprss13 A G 9: 45,333,688 probably benign Het
Tnfrsf14 A G 4: 154,926,597 probably null Het
Tpx2 A G 2: 152,867,367 probably benign Het
Vmn2r105 T A 17: 20,234,703 N57I probably damaging Het
Wars C T 12: 108,875,193 V220I probably benign Het
Washc1 T A 17: 66,116,719 D212E possibly damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Wdr43 A G 17: 71,626,825 D139G probably benign Het
Zfp235 A T 7: 24,137,131 H34L possibly damaging Het
Zkscan16 G A 4: 58,952,391 V230I probably benign Het
Other mutations in Serpini2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Serpini2 APN 3 75249242 missense probably damaging 1.00
IGL00736:Serpini2 APN 3 75267809 missense possibly damaging 0.70
IGL03398:Serpini2 APN 3 75259545 missense probably benign 0.00
R0545:Serpini2 UTSW 3 75258138 missense probably benign 0.04
R2309:Serpini2 UTSW 3 75259690 missense probably damaging 0.99
R2435:Serpini2 UTSW 3 75258168 missense probably benign 0.00
R2886:Serpini2 UTSW 3 75259614 missense probably damaging 1.00
R5054:Serpini2 UTSW 3 75259477 missense probably damaging 1.00
R5151:Serpini2 UTSW 3 75246513 missense possibly damaging 0.93
R5554:Serpini2 UTSW 3 75267988 start gained probably benign
R5614:Serpini2 UTSW 3 75257707 intron probably benign
R6413:Serpini2 UTSW 3 75259614 missense probably damaging 1.00
R6510:Serpini2 UTSW 3 75252568 missense probably damaging 0.97
R6688:Serpini2 UTSW 3 75259563 missense possibly damaging 0.88
R7178:Serpini2 UTSW 3 75258148 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTTTGCCAGAAGCCATATCCCC -3'
(R):5'- CTCAGAAGAGATTCTCACAGCCTGC -3'

Sequencing Primer
(F):5'- TAGCACACCTGATGTACAAAGTG -3'
(R):5'- CAATGAAGGGCAATCATGTCTG -3'
Posted On2013-05-09