Incidental Mutation 'R4661:Adamts7'
ID352866
Institutional Source Beutler Lab
Gene Symbol Adamts7
Ensembl Gene ENSMUSG00000032363
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 7
SynonymsADAM-TS7
MMRRC Submission 041600-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R4661 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location90163069-90208071 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 90193330 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1038 (H1038Q)
Ref Sequence ENSEMBL: ENSMUSP00000115972 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113059] [ENSMUST00000113060] [ENSMUST00000134996] [ENSMUST00000147250] [ENSMUST00000167122]
Predicted Effect probably benign
Transcript: ENSMUST00000113059
AA Change: H1080Q

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108682
Gene: ENSMUSG00000032363
AA Change: H1080Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 34 174 1.1e-36 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.3e-16 PFAM
Pfam:Reprolysin_4 224 425 8.5e-9 PFAM
Pfam:Reprolysin 226 437 2.2e-27 PFAM
Pfam:Reprolysin_2 244 427 2.9e-12 PFAM
Pfam:Reprolysin_3 248 383 5.2e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 2.2e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
TSP1 929 978 1.45e-6 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1211 1233 N/A INTRINSIC
TSP1 1385 1435 2.4e-2 SMART
TSP1 1436 1493 1.8e-2 SMART
TSP1 1495 1542 4.82e-2 SMART
TSP1 1543 1600 1.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113060
AA Change: H1038Q

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000108683
Gene: ENSMUSG00000032363
AA Change: H1038Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 3.4e-28 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.6e-16 PFAM
Pfam:Reprolysin_4 224 425 8.2e-9 PFAM
Pfam:Reprolysin 226 437 6.4e-30 PFAM
Pfam:Reprolysin_2 244 427 4.6e-12 PFAM
Pfam:Reprolysin_3 248 383 8.1e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 1.5e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
low complexity region 969 983 N/A INTRINSIC
low complexity region 1169 1191 N/A INTRINSIC
TSP1 1343 1393 2.4e-2 SMART
TSP1 1394 1451 1.8e-2 SMART
TSP1 1453 1500 4.82e-2 SMART
TSP1 1501 1558 1.39e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124441
Predicted Effect probably benign
Transcript: ENSMUST00000134996
SMART Domains Protein: ENSMUSP00000119744
Gene: ENSMUSG00000032363

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 2.4e-29 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 412 1e-17 PFAM
Pfam:Reprolysin_4 224 426 5e-10 PFAM
Pfam:Reprolysin 226 437 3.7e-31 PFAM
Pfam:Reprolysin_2 244 427 3.2e-13 PFAM
Pfam:Reprolysin_3 248 383 6.3e-14 PFAM
Blast:ACR 439 505 7e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144943
Predicted Effect probably benign
Transcript: ENSMUST00000147250
AA Change: H1038Q

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000115972
Gene: ENSMUSG00000032363
AA Change: H1038Q

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 2.7e-26 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 1.4e-14 PFAM
Pfam:Reprolysin_4 224 425 7e-7 PFAM
Pfam:Reprolysin 226 437 4.9e-28 PFAM
Pfam:Reprolysin_2 244 427 5e-10 PFAM
Pfam:Reprolysin_3 248 383 6.5e-11 PFAM
ACR 439 515 1.7e-5 SMART
TSP1 526 578 2.3e-15 SMART
Pfam:ADAM_spacer1 683 794 3.5e-34 PFAM
TSP1 807 863 6.9e-9 SMART
TSP1 866 908 1.2e-3 SMART
low complexity region 969 983 N/A INTRINSIC
low complexity region 1169 1191 N/A INTRINSIC
TSP1 1284 1334 1.2e-4 SMART
TSP1 1335 1392 8.7e-5 SMART
TSP1 1394 1441 2.3e-4 SMART
TSP1 1442 1499 6.5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167122
AA Change: H1080Q

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000129292
Gene: ENSMUSG00000032363
AA Change: H1080Q

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:Pep_M12B_propep 33 174 1.4e-28 PFAM
low complexity region 203 220 N/A INTRINSIC
Pfam:Reprolysin_5 224 411 7.2e-17 PFAM
Pfam:Reprolysin_4 224 425 3.6e-9 PFAM
Pfam:Reprolysin 226 437 2.9e-30 PFAM
Pfam:Reprolysin_2 244 427 2.2e-12 PFAM
Pfam:Reprolysin_3 248 383 3.7e-13 PFAM
Blast:ACR 442 513 5e-15 BLAST
TSP1 526 578 4.9e-13 SMART
Pfam:ADAM_spacer1 683 794 1.1e-36 PFAM
TSP1 807 863 1.45e-6 SMART
TSP1 866 908 2.41e-1 SMART
TSP1 929 978 1.45e-6 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1211 1233 N/A INTRINSIC
TSP1 1385 1435 2.4e-2 SMART
TSP1 1436 1493 1.8e-2 SMART
TSP1 1495 1542 4.82e-2 SMART
TSP1 1543 1600 1.39e-3 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. The encoded preproprotein undergoes proteolytic processing to generate an active, zinc-dependent enzyme that degrades cartilage oligomeric matrix protein. The deficiency of the encoded protein decreases atherosclerosis in genetically hyperlipidemic mice and in response to vascular injury. Alternative splicing results in multiple transcript variants encoding different isoforms, some of which may undergo similar processing. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygotes for a null allele show increased lung function parameters, reduced endothelial cell migration and proliferation, increased re-endothelialization and ameliorated neointima formation after carotid artery injury, and increased oval cell activation and biliary fibrosis after liver injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T C 9: 44,287,330 N42D probably damaging Het
Adamdec1 G A 14: 68,570,113 T366I probably damaging Het
Aff3 T C 1: 38,627,128 D5G possibly damaging Het
Amhr2 A T 15: 102,454,253 D485V probably damaging Het
Arhgap35 A T 7: 16,564,738 F134Y probably damaging Het
Asxl3 A G 18: 22,516,477 T508A probably benign Het
Atp10a TGGCGGCGGC TGGCGGC 7: 58,658,500 probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Atp9a A G 2: 168,637,672 F928L possibly damaging Het
BC034090 A T 1: 155,232,475 D13E probably damaging Het
Bco1 A G 8: 117,129,241 E425G probably benign Het
Brsk1 T C 7: 4,707,299 S436P possibly damaging Het
C1s1 T C 6: 124,536,490 I193V probably benign Het
Calb2 A G 8: 110,168,077 F21L probably benign Het
Catsperz T G 19: 6,924,803 T108P probably benign Het
Cep57l1 T A 10: 41,719,771 D329V possibly damaging Het
Cfdp1 A G 8: 111,830,945 F188S probably benign Het
Chrna2 G A 14: 66,148,843 G146D probably damaging Het
Col6a1 A C 10: 76,714,672 F520V unknown Het
Cyb5d2 C A 11: 72,778,945 V43L probably damaging Het
Cyp2c40 T C 19: 39,786,846 T321A probably benign Het
Dnajc16 A C 4: 141,763,548 Y764D probably damaging Het
Dsg1a G A 18: 20,340,533 V888M probably damaging Het
F5 A C 1: 164,184,920 T468P probably damaging Het
Faap24 A G 7: 35,395,084 M97T probably benign Het
Fam227b A T 2: 126,007,310 I334N probably damaging Het
Frem2 G T 3: 53,655,443 P548T probably damaging Het
Gfm1 A G 3: 67,433,398 E94G probably damaging Het
Gm17606 A T 14: 54,648,239 probably benign Het
Gnb2 A T 5: 137,530,253 M1K probably null Het
Gys1 G A 7: 45,454,834 A544T probably damaging Het
Hdac5 T C 11: 102,205,849 Y230C probably damaging Het
Hunk A T 16: 90,447,308 probably null Het
Ifnl2 A G 7: 28,510,210 F51L probably damaging Het
Itpr1 T C 6: 108,410,931 probably null Het
Kcnj1 A G 9: 32,396,622 Y114C probably benign Het
Kdm4b T A 17: 56,399,459 S322T probably damaging Het
Kif27 T C 13: 58,323,916 E786G probably damaging Het
Kif6 T C 17: 49,753,881 V414A probably benign Het
L1td1 A G 4: 98,733,624 K141R possibly damaging Het
Loxhd1 A G 18: 77,402,885 I1394V possibly damaging Het
Lrfn5 A T 12: 61,839,647 M74L probably damaging Het
Lrp6 C T 6: 134,511,267 D289N probably benign Het
Mroh7 A G 4: 106,691,513 probably null Het
Muc4 A C 16: 32,769,277 E2885A possibly damaging Het
Myo18b G T 5: 112,875,175 probably benign Het
Ncln G A 10: 81,493,068 A172V probably damaging Het
Nek9 G A 12: 85,320,892 T335M possibly damaging Het
Notch2 A G 3: 98,135,513 Y1398C probably damaging Het
Olfr472 A T 7: 107,902,981 H88L probably benign Het
Olfr710 T A 7: 106,944,867 I45F probably damaging Het
Olfr981 A T 9: 40,022,527 I45F probably damaging Het
Pax2 G A 19: 44,760,937 V40M probably damaging Het
Pde6c A G 19: 38,169,439 Y637C probably damaging Het
Plppr5 A G 3: 117,620,969 I80V probably damaging Het
Pold1 G T 7: 44,532,809 P1100T probably damaging Het
Prune2 T C 19: 17,000,023 Y41H probably damaging Het
Rgl2 C T 17: 33,933,226 A329V possibly damaging Het
Rilp T A 11: 75,511,424 Y250N probably damaging Het
Rilpl1 A G 5: 124,514,688 V19A probably benign Het
Rtp3 T C 9: 110,986,451 probably null Het
Rufy4 A G 1: 74,133,107 K246E probably damaging Het
Saraf C A 8: 34,168,462 A306E probably damaging Het
Slc26a8 A T 17: 28,638,684 N828K probably benign Het
Src C T 2: 157,469,932 P527S probably damaging Het
Susd3 C T 13: 49,231,302 probably null Het
Syngap1 T C 17: 26,966,906 L1270P probably damaging Het
Taf1c G A 8: 119,598,850 P758S probably damaging Het
Tenm2 A T 11: 36,024,448 N2087K probably damaging Het
Tfrc A T 16: 32,630,151 I703F probably damaging Het
Thap1 C G 8: 26,160,846 T48S probably benign Het
Tspear T C 10: 77,866,329 F199L probably benign Het
Usp17lc A T 7: 103,418,590 H364L probably benign Het
Usp9x A G X: 13,123,508 R776G possibly damaging Homo
Vmn1r1 T C 1: 182,157,224 E292G possibly damaging Het
Vmn1r125 T G 7: 21,272,627 V150G probably damaging Het
Vmn1r167 A T 7: 23,504,692 L300I probably damaging Het
Vmn2r106 A C 17: 20,267,623 I838S probably benign Het
Wdr64 A T 1: 175,726,494 S197C probably damaging Het
Zfp248 A T 6: 118,433,307 V47E possibly damaging Het
Other mutations in Adamts7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00547:Adamts7 APN 9 90194249 missense possibly damaging 0.71
IGL00673:Adamts7 APN 9 90193661 missense possibly damaging 0.78
IGL00902:Adamts7 APN 9 90188794 critical splice donor site probably null
IGL01303:Adamts7 APN 9 90171734 missense possibly damaging 0.46
IGL01333:Adamts7 APN 9 90186979 missense probably damaging 1.00
IGL01431:Adamts7 APN 9 90207785 missense possibly damaging 0.89
IGL01595:Adamts7 APN 9 90193306 missense probably benign 0.02
IGL02728:Adamts7 APN 9 90191827 splice site probably benign
IGL02860:Adamts7 APN 9 90191862 missense probably benign
IGL03237:Adamts7 APN 9 90188664 missense probably damaging 1.00
PIT4495001:Adamts7 UTSW 9 90174622 missense probably damaging 1.00
R0044:Adamts7 UTSW 9 90171588 missense possibly damaging 0.58
R0078:Adamts7 UTSW 9 90179411 missense probably damaging 1.00
R0107:Adamts7 UTSW 9 90180720 missense possibly damaging 0.82
R0122:Adamts7 UTSW 9 90179421 missense probably damaging 1.00
R0166:Adamts7 UTSW 9 90193692 missense probably benign 0.00
R0517:Adamts7 UTSW 9 90199858 missense probably benign 0.01
R1442:Adamts7 UTSW 9 90188770 missense probably damaging 0.99
R1468:Adamts7 UTSW 9 90188798 splice site probably benign
R1554:Adamts7 UTSW 9 90173650 missense probably damaging 1.00
R1612:Adamts7 UTSW 9 90188697 missense possibly damaging 0.86
R1652:Adamts7 UTSW 9 90189644 missense probably damaging 1.00
R2007:Adamts7 UTSW 9 90177856 missense probably damaging 1.00
R2091:Adamts7 UTSW 9 90188440 critical splice donor site probably null
R2202:Adamts7 UTSW 9 90180676 missense probably damaging 1.00
R2204:Adamts7 UTSW 9 90180676 missense probably damaging 1.00
R2205:Adamts7 UTSW 9 90180676 missense probably damaging 1.00
R2305:Adamts7 UTSW 9 90180711 missense probably benign 0.39
R2409:Adamts7 UTSW 9 90180687 missense probably damaging 1.00
R4157:Adamts7 UTSW 9 90188361 missense probably damaging 1.00
R4210:Adamts7 UTSW 9 90194010 missense possibly damaging 0.95
R4368:Adamts7 UTSW 9 90195851 critical splice donor site probably null
R4533:Adamts7 UTSW 9 90180708 missense probably damaging 1.00
R4608:Adamts7 UTSW 9 90174540 missense probably damaging 1.00
R4623:Adamts7 UTSW 9 90186462 missense probably benign 0.17
R4820:Adamts7 UTSW 9 90189686 missense possibly damaging 0.62
R4942:Adamts7 UTSW 9 90163311 missense probably benign
R4961:Adamts7 UTSW 9 90185740 missense probably damaging 1.00
R5064:Adamts7 UTSW 9 90195830 missense probably damaging 1.00
R5763:Adamts7 UTSW 9 90188409 missense probably damaging 1.00
R5921:Adamts7 UTSW 9 90188694 missense probably benign 0.20
R6027:Adamts7 UTSW 9 90191025 missense probably damaging 1.00
R6182:Adamts7 UTSW 9 90192436 missense probably benign 0.01
R6306:Adamts7 UTSW 9 90178278 critical splice donor site probably null
R6404:Adamts7 UTSW 9 90180456 intron probably null
R6488:Adamts7 UTSW 9 90171482 missense probably benign 0.00
R6649:Adamts7 UTSW 9 90191937 missense probably damaging 1.00
R6658:Adamts7 UTSW 9 90195300 missense probably damaging 0.99
R6874:Adamts7 UTSW 9 90188731 missense probably damaging 1.00
R6947:Adamts7 UTSW 9 90191804 intron probably null
R7110:Adamts7 UTSW 9 90193964 missense possibly damaging 0.92
R7224:Adamts7 UTSW 9 90185815 missense probably damaging 1.00
R7239:Adamts7 UTSW 9 90186557 splice site probably null
R7519:Adamts7 UTSW 9 90197079 missense probably benign 0.22
R7608:Adamts7 UTSW 9 90173773 missense possibly damaging 0.68
R7635:Adamts7 UTSW 9 90195245 missense probably damaging 1.00
X0028:Adamts7 UTSW 9 90178217 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TGACTTCATCCCGAACCAGC -3'
(R):5'- CTCAGTCAAGAAATTGGCCAGG -3'

Sequencing Primer
(F):5'- AAGCCGGTCAGCATCAGC -3'
(R):5'- AAATTGGCCAGGGGGTTGATG -3'
Posted On2015-10-08