Incidental Mutation 'R4661:Col6a1'
ID 352870
Institutional Source Beutler Lab
Gene Symbol Col6a1
Ensembl Gene ENSMUSG00000001119
Gene Name collagen, type VI, alpha 1
Synonyms Col6a-1
MMRRC Submission 041600-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.229) question?
Stock # R4661 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 76544626-76561878 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 76550506 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Valine at position 520 (F520V)
Ref Sequence ENSEMBL: ENSMUSP00000001147 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001147]
AlphaFold Q04857
Predicted Effect unknown
Transcript: ENSMUST00000001147
AA Change: F520V
SMART Domains Protein: ENSMUSP00000001147
Gene: ENSMUSG00000001119
AA Change: F520V

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
VWA 34 232 9.55e-29 SMART
Pfam:Collagen 252 312 5.6e-11 PFAM
Pfam:Collagen 292 367 2e-9 PFAM
Pfam:Collagen 345 423 3.6e-8 PFAM
Pfam:Collagen 448 515 1.1e-8 PFAM
Pfam:Collagen 499 563 1.9e-9 PFAM
low complexity region 571 590 N/A INTRINSIC
VWA 612 798 8.57e-31 SMART
VWA 824 1005 2.6e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137599
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The collagens are a superfamily of proteins that play a role in maintaining the integrity of various tissues. Collagens are extracellular matrix proteins and have a triple-helical domain as their common structural element. Collagen VI is a major structural component of microfibrils. The basic structural unit of collagen VI is a heterotrimer of the alpha1(VI), alpha2(VI), and alpha3(VI) chains. The alpha2(VI) and alpha3(VI) chains are encoded by the COL6A2 and COL6A3 genes, respectively. The protein encoded by this gene is the alpha 1 subunit of type VI collagen (alpha1(VI) chain). Mutations in the genes that code for the collagen VI subunits result in the autosomal dominant disorder, Bethlem myopathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for this targeted mutation display a myopathic disorder that resembles human Bethlem myopathy. Loss of contractile strength in affected muscles is associated with an unexpected latent mitochondrial dysfunction in myofibers, as well as spontaneous apoptosis. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T C 9: 44,198,627 (GRCm39) N42D probably damaging Het
Adamdec1 G A 14: 68,807,562 (GRCm39) T366I probably damaging Het
Adamts7 C A 9: 90,075,383 (GRCm39) H1038Q probably benign Het
Aff3 T C 1: 38,666,209 (GRCm39) D5G possibly damaging Het
Amhr2 A T 15: 102,362,688 (GRCm39) D485V probably damaging Het
Arhgap35 A T 7: 16,298,663 (GRCm39) F134Y probably damaging Het
Asxl3 A G 18: 22,649,534 (GRCm39) T508A probably benign Het
Atp10a TGGCGGCGGC TGGCGGC 7: 58,308,248 (GRCm39) probably benign Het
Atp4a G A 7: 30,419,650 (GRCm39) R671Q probably benign Het
Atp9a A G 2: 168,479,592 (GRCm39) F928L possibly damaging Het
BC034090 A T 1: 155,108,221 (GRCm39) D13E probably damaging Het
Bco1 A G 8: 117,855,980 (GRCm39) E425G probably benign Het
Brsk1 T C 7: 4,710,298 (GRCm39) S436P possibly damaging Het
C1s1 T C 6: 124,513,449 (GRCm39) I193V probably benign Het
Calb2 A G 8: 110,894,709 (GRCm39) F21L probably benign Het
Catsperz T G 19: 6,902,171 (GRCm39) T108P probably benign Het
Cep57l1 T A 10: 41,595,767 (GRCm39) D329V possibly damaging Het
Cfdp1 A G 8: 112,557,577 (GRCm39) F188S probably benign Het
Chrna2 G A 14: 66,386,292 (GRCm39) G146D probably damaging Het
Cyb5d2 C A 11: 72,669,771 (GRCm39) V43L probably damaging Het
Cyp2c40 T C 19: 39,775,290 (GRCm39) T321A probably benign Het
Dnajc16 A C 4: 141,490,859 (GRCm39) Y764D probably damaging Het
Dsg1a G A 18: 20,473,590 (GRCm39) V888M probably damaging Het
F5 A C 1: 164,012,489 (GRCm39) T468P probably damaging Het
Faap24 A G 7: 35,094,509 (GRCm39) M97T probably benign Het
Fam227b A T 2: 125,849,230 (GRCm39) I334N probably damaging Het
Frem2 G T 3: 53,562,864 (GRCm39) P548T probably damaging Het
Gfm1 A G 3: 67,340,731 (GRCm39) E94G probably damaging Het
Gm17606 A T 14: 54,885,696 (GRCm39) probably benign Het
Gnb2 A T 5: 137,528,515 (GRCm39) M1K probably null Het
Gys1 G A 7: 45,104,258 (GRCm39) A544T probably damaging Het
Hdac5 T C 11: 102,096,675 (GRCm39) Y230C probably damaging Het
Hunk A T 16: 90,244,196 (GRCm39) probably null Het
Ifnl2 A G 7: 28,209,635 (GRCm39) F51L probably damaging Het
Itpr1 T C 6: 108,387,892 (GRCm39) probably null Het
Kcnj1 A G 9: 32,307,918 (GRCm39) Y114C probably benign Het
Kdm4b T A 17: 56,706,459 (GRCm39) S322T probably damaging Het
Kif27 T C 13: 58,471,730 (GRCm39) E786G probably damaging Het
Kif6 T C 17: 50,060,909 (GRCm39) V414A probably benign Het
L1td1 A G 4: 98,621,861 (GRCm39) K141R possibly damaging Het
Loxhd1 A G 18: 77,490,581 (GRCm39) I1394V possibly damaging Het
Lrfn5 A T 12: 61,886,433 (GRCm39) M74L probably damaging Het
Lrp6 C T 6: 134,488,230 (GRCm39) D289N probably benign Het
Mroh7 A G 4: 106,548,710 (GRCm39) probably null Het
Muc4 A C 16: 32,589,651 (GRCm39) E2885A possibly damaging Het
Myo18b G T 5: 113,023,041 (GRCm39) probably benign Het
Ncln G A 10: 81,328,902 (GRCm39) A172V probably damaging Het
Nek9 G A 12: 85,367,666 (GRCm39) T335M possibly damaging Het
Notch2 A G 3: 98,042,829 (GRCm39) Y1398C probably damaging Het
Or10g6 A T 9: 39,933,823 (GRCm39) I45F probably damaging Het
Or2d4 T A 7: 106,544,074 (GRCm39) I45F probably damaging Het
Or5p52 A T 7: 107,502,188 (GRCm39) H88L probably benign Het
Pax2 G A 19: 44,749,376 (GRCm39) V40M probably damaging Het
Pde6c A G 19: 38,157,887 (GRCm39) Y637C probably damaging Het
Plppr5 A G 3: 117,414,618 (GRCm39) I80V probably damaging Het
Pold1 G T 7: 44,182,233 (GRCm39) P1100T probably damaging Het
Prune2 T C 19: 16,977,387 (GRCm39) Y41H probably damaging Het
Rgl2 C T 17: 34,152,200 (GRCm39) A329V possibly damaging Het
Rilp T A 11: 75,402,250 (GRCm39) Y250N probably damaging Het
Rilpl1 A G 5: 124,652,751 (GRCm39) V19A probably benign Het
Rtp3 T C 9: 110,815,519 (GRCm39) probably null Het
Rufy4 A G 1: 74,172,266 (GRCm39) K246E probably damaging Het
Saraf C A 8: 34,635,616 (GRCm39) A306E probably damaging Het
Slc26a8 A T 17: 28,857,658 (GRCm39) N828K probably benign Het
Src C T 2: 157,311,852 (GRCm39) P527S probably damaging Het
Susd3 C T 13: 49,384,778 (GRCm39) probably null Het
Syngap1 T C 17: 27,185,880 (GRCm39) L1270P probably damaging Het
Taf1c G A 8: 120,325,589 (GRCm39) P758S probably damaging Het
Tenm2 A T 11: 35,915,275 (GRCm39) N2087K probably damaging Het
Tfrc A T 16: 32,448,969 (GRCm39) I703F probably damaging Het
Thap1 C G 8: 26,650,874 (GRCm39) T48S probably benign Het
Tspear T C 10: 77,702,163 (GRCm39) F199L probably benign Het
Usp17lc A T 7: 103,067,797 (GRCm39) H364L probably benign Het
Usp9x A G X: 12,989,747 (GRCm39) R776G possibly damaging Homo
Vmn1r1 T C 1: 181,984,789 (GRCm39) E292G possibly damaging Het
Vmn1r125 T G 7: 21,006,552 (GRCm39) V150G probably damaging Het
Vmn1r167 A T 7: 23,204,117 (GRCm39) L300I probably damaging Het
Vmn2r106 A C 17: 20,487,885 (GRCm39) I838S probably benign Het
Wdr64 A T 1: 175,554,060 (GRCm39) S197C probably damaging Het
Zfp248 A T 6: 118,410,268 (GRCm39) V47E possibly damaging Het
Other mutations in Col6a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01327:Col6a1 APN 10 76,546,813 (GRCm39) missense unknown
IGL01943:Col6a1 APN 10 76,554,957 (GRCm39) critical splice donor site probably null
IGL02178:Col6a1 APN 10 76,546,909 (GRCm39) missense unknown
IGL02928:Col6a1 APN 10 76,545,500 (GRCm39) missense possibly damaging 0.93
IGL03162:Col6a1 APN 10 76,553,885 (GRCm39) splice site probably benign
P0005:Col6a1 UTSW 10 76,553,163 (GRCm39) splice site probably benign
R0398:Col6a1 UTSW 10 76,545,952 (GRCm39) missense unknown
R0631:Col6a1 UTSW 10 76,545,569 (GRCm39) missense probably benign 0.03
R0698:Col6a1 UTSW 10 76,552,114 (GRCm39) missense unknown
R0699:Col6a1 UTSW 10 76,552,114 (GRCm39) missense unknown
R0848:Col6a1 UTSW 10 76,549,458 (GRCm39) critical splice donor site probably null
R1053:Col6a1 UTSW 10 76,556,800 (GRCm39) missense probably damaging 0.99
R1235:Col6a1 UTSW 10 76,548,158 (GRCm39) missense unknown
R1480:Col6a1 UTSW 10 76,545,752 (GRCm39) missense unknown
R1854:Col6a1 UTSW 10 76,557,783 (GRCm39) missense probably damaging 1.00
R1995:Col6a1 UTSW 10 76,557,790 (GRCm39) missense probably damaging 1.00
R2082:Col6a1 UTSW 10 76,545,430 (GRCm39) missense probably damaging 0.98
R2122:Col6a1 UTSW 10 76,557,332 (GRCm39) missense probably benign 0.10
R2411:Col6a1 UTSW 10 76,546,922 (GRCm39) missense unknown
R3236:Col6a1 UTSW 10 76,547,154 (GRCm39) missense unknown
R3417:Col6a1 UTSW 10 76,548,203 (GRCm39) missense unknown
R3832:Col6a1 UTSW 10 76,546,951 (GRCm39) missense unknown
R3843:Col6a1 UTSW 10 76,547,175 (GRCm39) missense unknown
R3903:Col6a1 UTSW 10 76,547,175 (GRCm39) missense unknown
R3904:Col6a1 UTSW 10 76,547,175 (GRCm39) missense unknown
R4409:Col6a1 UTSW 10 76,557,334 (GRCm39) missense probably benign 0.17
R4418:Col6a1 UTSW 10 76,554,239 (GRCm39) nonsense probably null
R4568:Col6a1 UTSW 10 76,555,031 (GRCm39) intron probably benign
R4579:Col6a1 UTSW 10 76,547,191 (GRCm39) missense unknown
R4945:Col6a1 UTSW 10 76,548,106 (GRCm39) missense unknown
R4958:Col6a1 UTSW 10 76,559,339 (GRCm39) missense probably damaging 1.00
R5101:Col6a1 UTSW 10 76,545,740 (GRCm39) missense unknown
R5440:Col6a1 UTSW 10 76,559,288 (GRCm39) missense probably damaging 1.00
R5924:Col6a1 UTSW 10 76,554,205 (GRCm39) critical splice donor site probably null
R6030:Col6a1 UTSW 10 76,545,700 (GRCm39) missense unknown
R6030:Col6a1 UTSW 10 76,545,700 (GRCm39) missense unknown
R6366:Col6a1 UTSW 10 76,546,804 (GRCm39) missense unknown
R6435:Col6a1 UTSW 10 76,546,957 (GRCm39) missense unknown
R6718:Col6a1 UTSW 10 76,560,884 (GRCm39) missense probably damaging 1.00
R7014:Col6a1 UTSW 10 76,557,277 (GRCm39) missense probably damaging 1.00
R7117:Col6a1 UTSW 10 76,560,843 (GRCm39) missense probably damaging 1.00
R7153:Col6a1 UTSW 10 76,546,175 (GRCm39) splice site probably null
R7183:Col6a1 UTSW 10 76,552,093 (GRCm39) critical splice donor site probably null
R7244:Col6a1 UTSW 10 76,553,242 (GRCm39) nonsense probably null
R7625:Col6a1 UTSW 10 76,549,760 (GRCm39) missense unknown
R7741:Col6a1 UTSW 10 76,545,743 (GRCm39) missense unknown
R7774:Col6a1 UTSW 10 76,545,710 (GRCm39) missense unknown
R7834:Col6a1 UTSW 10 76,545,762 (GRCm39) missense unknown
R8145:Col6a1 UTSW 10 76,559,305 (GRCm39) missense possibly damaging 0.46
R8177:Col6a1 UTSW 10 76,560,863 (GRCm39) missense probably damaging 1.00
R8932:Col6a1 UTSW 10 76,552,593 (GRCm39) missense unknown
R9060:Col6a1 UTSW 10 76,557,711 (GRCm39) missense probably benign 0.21
R9411:Col6a1 UTSW 10 76,547,487 (GRCm39) missense unknown
RF019:Col6a1 UTSW 10 76,547,449 (GRCm39) missense unknown
X0010:Col6a1 UTSW 10 76,559,372 (GRCm39) missense probably damaging 1.00
X0067:Col6a1 UTSW 10 76,545,809 (GRCm39) missense unknown
Z1088:Col6a1 UTSW 10 76,545,393 (GRCm39) makesense probably null
Predicted Primers PCR Primer
(F):5'- CCTGGATACCCCTGTGAAGAAG -3'
(R):5'- TAAGGTTCAGCTCGGGGTAG -3'

Sequencing Primer
(F):5'- AGGATGGTTATACTAAGCTCCACTGG -3'
(R):5'- TCTGGCATGATGACAGCA -3'
Posted On 2015-10-08