Incidental Mutation 'R0271:Ampd2'
ID35288
Institutional Source Beutler Lab
Gene Symbol Ampd2
Ensembl Gene ENSMUSG00000027889
Gene Nameadenosine monophosphate deaminase 2
Synonyms1200014F01Rik, Ampd-2
MMRRC Submission 038497-MU
Accession Numbers

Genbank: NM_028779; MGI: 88016

Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R0271 (G1)
Quality Score164
Status Validated
Chromosome3
Chromosomal Location108074062-108086651 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 108086716 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000099698 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078912] [ENSMUST00000102637] [ENSMUST00000102638]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000070502
Predicted Effect probably benign
Transcript: ENSMUST00000078912
SMART Domains Protein: ENSMUSP00000077946
Gene: ENSMUSG00000027889

DomainStartEndE-ValueType
low complexity region 99 111 N/A INTRINSIC
Pfam:A_deaminase 357 764 3.3e-137 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102637
SMART Domains Protein: ENSMUSP00000099697
Gene: ENSMUSG00000027889

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:A_deaminase 331 738 7.5e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102638
SMART Domains Protein: ENSMUSP00000099698
Gene: ENSMUSG00000027889

DomainStartEndE-ValueType
low complexity region 73 85 N/A INTRINSIC
Pfam:A_deaminase 331 738 7.5e-125 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136712
SMART Domains Protein: ENSMUSP00000122431
Gene: ENSMUSG00000027889

DomainStartEndE-ValueType
Pfam:A_deaminase 97 165 4.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153626
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186471
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is important in purine metabolism by converting AMP to IMP. The encoded protein, which acts as a homotetramer, is one of three AMP deaminases found in mammals. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit proteinuria, tubules filled with protein casts and podocyte process effacement. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Gene trapped(5)

Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,686,329 probably benign Het
4930544D05Rik A G 11: 70,616,648 Q173R possibly damaging Het
Ankrd17 T C 5: 90,254,799 S1467G possibly damaging Het
Arhgap31 T G 16: 38,602,510 S1065R possibly damaging Het
Arhgef19 G T 4: 141,250,607 M542I probably benign Het
C7 T C 15: 5,015,380 D392G possibly damaging Het
Ccdc138 G A 10: 58,575,823 C671Y probably damaging Het
Cdh8 A G 8: 99,111,715 S498P possibly damaging Het
Cpb2 T A 14: 75,257,709 probably null Het
Cwc22 A C 2: 77,920,858 N389K probably benign Het
Dgkb T A 12: 38,228,026 L550Q probably damaging Het
Dip2c A G 13: 9,615,775 R950G probably damaging Het
Eml6 A G 11: 29,848,949 V437A possibly damaging Het
Fanca T C 8: 123,272,441 probably benign Het
Fgd2 C G 17: 29,367,008 L189V possibly damaging Het
Foxred2 A C 15: 77,943,390 S590A possibly damaging Het
Gm1110 A G 9: 26,920,666 F63S probably damaging Het
Gm14496 A T 2: 181,995,954 M274L probably benign Het
Gm7008 T A 12: 40,223,560 probably benign Het
Gm9922 T A 14: 101,729,553 probably benign Het
Gtf3c3 A T 1: 54,428,812 M222K possibly damaging Het
Hspa1b A G 17: 34,958,832 V59A probably benign Het
Impg1 T C 9: 80,386,879 probably benign Het
Lpcat4 T A 2: 112,243,245 probably null Het
Mipol1 T C 12: 57,460,954 probably benign Het
Mrpl37 C A 4: 107,066,461 R112L possibly damaging Het
Myo18b T C 5: 112,809,685 N1471D possibly damaging Het
Nes G A 3: 87,978,642 E1359K possibly damaging Het
Nipbl A T 15: 8,361,737 V251E possibly damaging Het
Nlrp1b T C 11: 71,161,765 I946V possibly damaging Het
Obscn T G 11: 59,056,742 probably benign Het
Olfr1024 A T 2: 85,904,289 M255K possibly damaging Het
Olfr1239 T A 2: 89,418,158 Y85F probably benign Het
Olfr1491 A T 19: 13,705,135 T103S probably benign Het
Olfr635 T A 7: 103,979,630 I146K possibly damaging Het
Pck2 T C 14: 55,544,584 probably null Het
Pcsk9 A G 4: 106,449,049 probably benign Het
Phyhd1 A T 2: 30,269,822 Q56L probably benign Het
Plxnc1 C T 10: 94,837,918 G1001S probably null Het
Prss52 T C 14: 64,113,678 V304A probably benign Het
Prss55 C T 14: 64,075,607 G276D probably benign Het
Pzp A T 6: 128,519,514 Y252N probably damaging Het
Rad1 T C 15: 10,490,457 probably null Het
Ripply3 A T 16: 94,335,757 E92D possibly damaging Het
Rpp30 T A 19: 36,104,403 D255E probably benign Het
Rsad1 T C 11: 94,548,464 probably benign Het
Serpini2 A G 3: 75,246,578 M358T probably damaging Het
Slc35a1 T A 4: 34,664,125 E331V probably benign Het
Slc38a7 A G 8: 95,845,878 F179L probably damaging Het
Stmn4 C T 14: 66,356,283 Q42* probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tab2 G A 10: 7,919,158 A520V probably benign Het
Tcp10a A G 17: 7,331,156 I162M probably benign Het
Tmprss13 A G 9: 45,333,688 probably benign Het
Tnfrsf14 A G 4: 154,926,597 probably null Het
Tpx2 A G 2: 152,867,367 probably benign Het
Vmn2r105 T A 17: 20,234,703 N57I probably damaging Het
Wars C T 12: 108,875,193 V220I probably benign Het
Washc1 T A 17: 66,116,719 D212E possibly damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Wdr43 A G 17: 71,626,825 D139G probably benign Het
Zfp235 A T 7: 24,137,131 H34L possibly damaging Het
Zkscan16 G A 4: 58,952,391 V230I probably benign Het
Other mutations in Ampd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00502:Ampd2 APN 3 108077396 missense probably damaging 1.00
IGL02142:Ampd2 APN 3 108080344 splice site probably benign
IGL02174:Ampd2 APN 3 108080285 missense probably damaging 0.96
IGL02686:Ampd2 APN 3 108076495 missense possibly damaging 0.62
IGL03326:Ampd2 APN 3 108079287 missense probably benign 0.02
IGL03493:Ampd2 APN 3 108075358 missense probably damaging 1.00
D4186:Ampd2 UTSW 3 108081111 missense probably benign 0.00
H8562:Ampd2 UTSW 3 108081111 missense probably benign 0.00
PIT4445001:Ampd2 UTSW 3 108075012 missense probably damaging 1.00
R0835:Ampd2 UTSW 3 108076502 missense possibly damaging 0.48
R0975:Ampd2 UTSW 3 108077121 missense probably damaging 1.00
R1061:Ampd2 UTSW 3 108075689 missense probably damaging 1.00
R1466:Ampd2 UTSW 3 108080337 critical splice acceptor site probably null
R1466:Ampd2 UTSW 3 108080337 critical splice acceptor site probably null
R1584:Ampd2 UTSW 3 108080337 critical splice acceptor site probably null
R2034:Ampd2 UTSW 3 108077363 missense possibly damaging 0.91
R2164:Ampd2 UTSW 3 108085369 intron probably benign
R3040:Ampd2 UTSW 3 108076416 missense probably damaging 1.00
R3052:Ampd2 UTSW 3 108086487 utr 5 prime probably benign
R4329:Ampd2 UTSW 3 108077787 intron probably benign
R4425:Ampd2 UTSW 3 108086736 unclassified probably benign
R5073:Ampd2 UTSW 3 108079233 missense probably damaging 0.99
R5074:Ampd2 UTSW 3 108079233 missense probably damaging 0.99
R5180:Ampd2 UTSW 3 108079042 missense probably benign 0.00
R5256:Ampd2 UTSW 3 108079549 intron probably benign
R5507:Ampd2 UTSW 3 108077613 missense probably damaging 1.00
R5513:Ampd2 UTSW 3 108075667 missense possibly damaging 0.85
R5955:Ampd2 UTSW 3 108079772 missense probably damaging 1.00
R6941:Ampd2 UTSW 3 108079293 missense probably damaging 0.99
R7744:Ampd2 UTSW 3 108080116 missense probably benign
R7745:Ampd2 UTSW 3 108080116 missense probably benign
R7815:Ampd2 UTSW 3 108074931 missense probably benign 0.06
Z1176:Ampd2 UTSW 3 108080064 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TACGAAAGTCTGCACAGCGAGG -3'
(R):5'- TCTGCTTGAAATGGATTCTGGGACC -3'

Sequencing Primer
(F):5'- TTCAGCGGCCAGACTGAC -3'
(R):5'- atttaccttcagtcctcagtaactc -3'
Posted On2013-05-09