Incidental Mutation 'R4661:Chrna2'
ID352883
Institutional Source Beutler Lab
Gene Symbol Chrna2
Ensembl Gene ENSMUSG00000022041
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal)
SynonymsAcra-2, Acra2
MMRRC Submission 041600-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4661 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location66135039-66152948 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 66148843 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 146 (G146D)
Ref Sequence ENSEMBL: ENSMUSP00000145896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022620] [ENSMUST00000022622] [ENSMUST00000089250] [ENSMUST00000178730] [ENSMUST00000206455]
Predicted Effect probably damaging
Transcript: ENSMUST00000022620
AA Change: G146D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022620
Gene: ENSMUSG00000022041
AA Change: G146D

DomainStartEndE-ValueType
Pfam:Neur_chan_LBD 36 242 2.2e-81 PFAM
Pfam:Neur_chan_memb 249 503 5e-97 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000022622
SMART Domains Protein: ENSMUSP00000022622
Gene: ENSMUSG00000059456

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 870 1008 1.7e-67 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000089250
SMART Domains Protein: ENSMUSP00000086661
Gene: ENSMUSG00000059456

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 828 966 2e-68 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136216
Predicted Effect probably benign
Transcript: ENSMUST00000154865
SMART Domains Protein: ENSMUSP00000122683
Gene: ENSMUSG00000059456

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 83 8.5e-27 PFAM
low complexity region 117 130 N/A INTRINSIC
Pfam:Focal_AT 243 375 5e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000178730
SMART Domains Protein: ENSMUSP00000137008
Gene: ENSMUSG00000059456

DomainStartEndE-ValueType
B41 35 265 1.33e-45 SMART
TyrKc 425 679 1.46e-139 SMART
low complexity region 713 726 N/A INTRINSIC
Pfam:Focal_AT 870 1002 2.1e-55 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206455
AA Change: G146D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nicotinic acetylcholine receptors (nAChRs) are ligand-gated ion channels formed by a pentameric arrangement of alpha and beta subunits to create distinct muscle and neuronal receptors. Neuronal receptors are found throughout the peripheral and central nervous system where they are involved in fast synaptic transmission. This gene encodes an alpha subunit that is widely expressed in the brain. The proposed structure for nAChR subunits is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. Mutations in this gene cause autosomal dominant nocturnal frontal lobe epilepsy type 4. Single nucleotide polymorphisms (SNPs) in this gene have been associated with nicotine dependence. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a targeted null mutation do not exhibit any significant abnormalities compared to controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T C 9: 44,287,330 N42D probably damaging Het
Adamdec1 G A 14: 68,570,113 T366I probably damaging Het
Adamts7 C A 9: 90,193,330 H1038Q probably benign Het
Aff3 T C 1: 38,627,128 D5G possibly damaging Het
Amhr2 A T 15: 102,454,253 D485V probably damaging Het
Arhgap35 A T 7: 16,564,738 F134Y probably damaging Het
Asxl3 A G 18: 22,516,477 T508A probably benign Het
Atp10a TGGCGGCGGC TGGCGGC 7: 58,658,500 probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Atp9a A G 2: 168,637,672 F928L possibly damaging Het
BC034090 A T 1: 155,232,475 D13E probably damaging Het
Bco1 A G 8: 117,129,241 E425G probably benign Het
Brsk1 T C 7: 4,707,299 S436P possibly damaging Het
C1s1 T C 6: 124,536,490 I193V probably benign Het
Calb2 A G 8: 110,168,077 F21L probably benign Het
Catsperz T G 19: 6,924,803 T108P probably benign Het
Cep57l1 T A 10: 41,719,771 D329V possibly damaging Het
Cfdp1 A G 8: 111,830,945 F188S probably benign Het
Col6a1 A C 10: 76,714,672 F520V unknown Het
Cyb5d2 C A 11: 72,778,945 V43L probably damaging Het
Cyp2c40 T C 19: 39,786,846 T321A probably benign Het
Dnajc16 A C 4: 141,763,548 Y764D probably damaging Het
Dsg1a G A 18: 20,340,533 V888M probably damaging Het
F5 A C 1: 164,184,920 T468P probably damaging Het
Faap24 A G 7: 35,395,084 M97T probably benign Het
Fam227b A T 2: 126,007,310 I334N probably damaging Het
Frem2 G T 3: 53,655,443 P548T probably damaging Het
Gfm1 A G 3: 67,433,398 E94G probably damaging Het
Gm17606 A T 14: 54,648,239 probably benign Het
Gnb2 A T 5: 137,530,253 M1K probably null Het
Gys1 G A 7: 45,454,834 A544T probably damaging Het
Hdac5 T C 11: 102,205,849 Y230C probably damaging Het
Hunk A T 16: 90,447,308 probably null Het
Ifnl2 A G 7: 28,510,210 F51L probably damaging Het
Itpr1 T C 6: 108,410,931 probably null Het
Kcnj1 A G 9: 32,396,622 Y114C probably benign Het
Kdm4b T A 17: 56,399,459 S322T probably damaging Het
Kif27 T C 13: 58,323,916 E786G probably damaging Het
Kif6 T C 17: 49,753,881 V414A probably benign Het
L1td1 A G 4: 98,733,624 K141R possibly damaging Het
Loxhd1 A G 18: 77,402,885 I1394V possibly damaging Het
Lrfn5 A T 12: 61,839,647 M74L probably damaging Het
Lrp6 C T 6: 134,511,267 D289N probably benign Het
Mroh7 A G 4: 106,691,513 probably null Het
Muc4 A C 16: 32,769,277 E2885A possibly damaging Het
Myo18b G T 5: 112,875,175 probably benign Het
Ncln G A 10: 81,493,068 A172V probably damaging Het
Nek9 G A 12: 85,320,892 T335M possibly damaging Het
Notch2 A G 3: 98,135,513 Y1398C probably damaging Het
Olfr472 A T 7: 107,902,981 H88L probably benign Het
Olfr710 T A 7: 106,944,867 I45F probably damaging Het
Olfr981 A T 9: 40,022,527 I45F probably damaging Het
Pax2 G A 19: 44,760,937 V40M probably damaging Het
Pde6c A G 19: 38,169,439 Y637C probably damaging Het
Plppr5 A G 3: 117,620,969 I80V probably damaging Het
Pold1 G T 7: 44,532,809 P1100T probably damaging Het
Prune2 T C 19: 17,000,023 Y41H probably damaging Het
Rgl2 C T 17: 33,933,226 A329V possibly damaging Het
Rilp T A 11: 75,511,424 Y250N probably damaging Het
Rilpl1 A G 5: 124,514,688 V19A probably benign Het
Rtp3 T C 9: 110,986,451 probably null Het
Rufy4 A G 1: 74,133,107 K246E probably damaging Het
Saraf C A 8: 34,168,462 A306E probably damaging Het
Slc26a8 A T 17: 28,638,684 N828K probably benign Het
Src C T 2: 157,469,932 P527S probably damaging Het
Susd3 C T 13: 49,231,302 probably null Het
Syngap1 T C 17: 26,966,906 L1270P probably damaging Het
Taf1c G A 8: 119,598,850 P758S probably damaging Het
Tenm2 A T 11: 36,024,448 N2087K probably damaging Het
Tfrc A T 16: 32,630,151 I703F probably damaging Het
Thap1 C G 8: 26,160,846 T48S probably benign Het
Tspear T C 10: 77,866,329 F199L probably benign Het
Usp17lc A T 7: 103,418,590 H364L probably benign Het
Usp9x A G X: 13,123,508 R776G possibly damaging Homo
Vmn1r1 T C 1: 182,157,224 E292G possibly damaging Het
Vmn1r125 T G 7: 21,272,627 V150G probably damaging Het
Vmn1r167 A T 7: 23,504,692 L300I probably damaging Het
Vmn2r106 A C 17: 20,267,623 I838S probably benign Het
Wdr64 A T 1: 175,726,494 S197C probably damaging Het
Zfp248 A T 6: 118,433,307 V47E possibly damaging Het
Other mutations in Chrna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02738:Chrna2 APN 14 66149440 missense probably benign 0.01
IGL03172:Chrna2 APN 14 66142239 missense probably benign
IGL03268:Chrna2 APN 14 66150946 splice site probably benign
IGL03344:Chrna2 APN 14 66150966 missense probably damaging 0.99
intrepid UTSW 14 66146453 missense probably damaging 1.00
PIT1430001:Chrna2 UTSW 14 66149737 missense probably benign 0.01
R0511:Chrna2 UTSW 14 66149104 missense probably damaging 1.00
R0631:Chrna2 UTSW 14 66149308 missense probably benign 0.45
R1205:Chrna2 UTSW 14 66143363 missense probably benign 0.00
R1485:Chrna2 UTSW 14 66143363 missense probably benign 0.00
R1487:Chrna2 UTSW 14 66143363 missense probably benign 0.00
R1513:Chrna2 UTSW 14 66143429 missense probably benign 0.13
R2023:Chrna2 UTSW 14 66142228 missense probably benign 0.25
R2094:Chrna2 UTSW 14 66149463 missense possibly damaging 0.65
R2964:Chrna2 UTSW 14 66149368 missense possibly damaging 0.82
R2966:Chrna2 UTSW 14 66149368 missense possibly damaging 0.82
R3118:Chrna2 UTSW 14 66150993 missense probably damaging 0.98
R3931:Chrna2 UTSW 14 66149767 missense probably benign 0.26
R3979:Chrna2 UTSW 14 66148953 missense probably damaging 1.00
R3983:Chrna2 UTSW 14 66149457 missense probably benign 0.00
R4080:Chrna2 UTSW 14 66143417 missense probably benign 0.12
R4080:Chrna2 UTSW 14 66143424 nonsense probably null
R4508:Chrna2 UTSW 14 66146453 missense probably damaging 1.00
R4726:Chrna2 UTSW 14 66148896 missense possibly damaging 0.85
R5349:Chrna2 UTSW 14 66143507 missense probably damaging 0.99
R5787:Chrna2 UTSW 14 66149008 missense probably benign 0.16
R6967:Chrna2 UTSW 14 66150949 critical splice acceptor site probably null
R7218:Chrna2 UTSW 14 66143871 intron probably null
R7274:Chrna2 UTSW 14 66149226 missense probably benign 0.03
R7565:Chrna2 UTSW 14 66151035 missense probably benign
Z1176:Chrna2 UTSW 14 66149304 missense probably damaging 1.00
Z1177:Chrna2 UTSW 14 66151027 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCCCTTGCTTGGATGAC -3'
(R):5'- CAGTCGTACTTCTTGCTGTTATAGG -3'

Sequencing Primer
(F):5'- GCTTGGATGACTCTACTTAGCCAG -3'
(R):5'- GCGTTGATAATGGCCCACTC -3'
Posted On2015-10-08