Incidental Mutation 'R4661:Amhr2'
ID352885
Institutional Source Beutler Lab
Gene Symbol Amhr2
Ensembl Gene ENSMUSG00000023047
Gene Nameanti-Mullerian hormone type 2 receptor
SynonymsMIS TypeII receptor, MISIIR
MMRRC Submission 041600-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.795) question?
Stock #R4661 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location102445367-102454633 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 102454253 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 485 (D485V)
Ref Sequence ENSEMBL: ENSMUSP00000023809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023809] [ENSMUST00000023810] [ENSMUST00000164938] [ENSMUST00000164957] [ENSMUST00000171245] [ENSMUST00000229278]
Predicted Effect probably damaging
Transcript: ENSMUST00000023809
AA Change: D485V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023809
Gene: ENSMUSG00000023047
AA Change: D485V

DomainStartEndE-ValueType
Pfam:Activin_recp 46 124 3.4e-7 PFAM
transmembrane domain 146 168 N/A INTRINSIC
low complexity region 177 188 N/A INTRINSIC
Pfam:Pkinase 199 501 4.6e-25 PFAM
Pfam:Pkinase_Tyr 199 501 2.6e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000023810
SMART Domains Protein: ENSMUSP00000023810
Gene: ENSMUSG00000023048

DomainStartEndE-ValueType
low complexity region 22 48 N/A INTRINSIC
low complexity region 50 85 N/A INTRINSIC
low complexity region 102 136 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158543
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161376
Predicted Effect unknown
Transcript: ENSMUST00000162893
AA Change: D106V
SMART Domains Protein: ENSMUSP00000123735
Gene: ENSMUSG00000023047
AA Change: D106V

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 3 73 2.4e-8 PFAM
Pfam:Pkinase 6 84 1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164938
SMART Domains Protein: ENSMUSP00000129218
Gene: ENSMUSG00000023048

DomainStartEndE-ValueType
low complexity region 22 48 N/A INTRINSIC
low complexity region 50 79 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164957
SMART Domains Protein: ENSMUSP00000125784
Gene: ENSMUSG00000023048

DomainStartEndE-ValueType
low complexity region 22 48 N/A INTRINSIC
low complexity region 50 85 N/A INTRINSIC
low complexity region 102 136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171245
SMART Domains Protein: ENSMUSP00000132636
Gene: ENSMUSG00000023048

DomainStartEndE-ValueType
low complexity region 22 48 N/A INTRINSIC
low complexity region 50 85 N/A INTRINSIC
low complexity region 102 136 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181328
Predicted Effect silent
Transcript: ENSMUST00000229278
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the receptor for the anti-Mullerian hormone (AMH) which, in addition to testosterone, results in male sex differentiation. AMH and testosterone are produced in the testes by different cells and have different effects. Testosterone promotes the development of male genitalia while the binding of AMH to the encoded receptor prevents the development of the mullerian ducts into uterus and Fallopian tubes. Mutations in this gene are associated with persistent Mullerian duct syndrome type II. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Sep 2009]
PHENOTYPE: Homozygous null mutant males have a complete male reproductive tract, but also a uterus and oviducts. Functional sperm are produced, but most males are infertile because female reproductive organs block sperm transfer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T C 9: 44,287,330 N42D probably damaging Het
Adamdec1 G A 14: 68,570,113 T366I probably damaging Het
Adamts7 C A 9: 90,193,330 H1038Q probably benign Het
Aff3 T C 1: 38,627,128 D5G possibly damaging Het
Arhgap35 A T 7: 16,564,738 F134Y probably damaging Het
Asxl3 A G 18: 22,516,477 T508A probably benign Het
Atp10a TGGCGGCGGC TGGCGGC 7: 58,658,500 probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Atp9a A G 2: 168,637,672 F928L possibly damaging Het
BC034090 A T 1: 155,232,475 D13E probably damaging Het
Bco1 A G 8: 117,129,241 E425G probably benign Het
Brsk1 T C 7: 4,707,299 S436P possibly damaging Het
C1s1 T C 6: 124,536,490 I193V probably benign Het
Calb2 A G 8: 110,168,077 F21L probably benign Het
Catsperz T G 19: 6,924,803 T108P probably benign Het
Cep57l1 T A 10: 41,719,771 D329V possibly damaging Het
Cfdp1 A G 8: 111,830,945 F188S probably benign Het
Chrna2 G A 14: 66,148,843 G146D probably damaging Het
Col6a1 A C 10: 76,714,672 F520V unknown Het
Cyb5d2 C A 11: 72,778,945 V43L probably damaging Het
Cyp2c40 T C 19: 39,786,846 T321A probably benign Het
Dnajc16 A C 4: 141,763,548 Y764D probably damaging Het
Dsg1a G A 18: 20,340,533 V888M probably damaging Het
F5 A C 1: 164,184,920 T468P probably damaging Het
Faap24 A G 7: 35,395,084 M97T probably benign Het
Fam227b A T 2: 126,007,310 I334N probably damaging Het
Frem2 G T 3: 53,655,443 P548T probably damaging Het
Gfm1 A G 3: 67,433,398 E94G probably damaging Het
Gm17606 A T 14: 54,648,239 probably benign Het
Gnb2 A T 5: 137,530,253 M1K probably null Het
Gys1 G A 7: 45,454,834 A544T probably damaging Het
Hdac5 T C 11: 102,205,849 Y230C probably damaging Het
Hunk A T 16: 90,447,308 probably null Het
Ifnl2 A G 7: 28,510,210 F51L probably damaging Het
Itpr1 T C 6: 108,410,931 probably null Het
Kcnj1 A G 9: 32,396,622 Y114C probably benign Het
Kdm4b T A 17: 56,399,459 S322T probably damaging Het
Kif27 T C 13: 58,323,916 E786G probably damaging Het
Kif6 T C 17: 49,753,881 V414A probably benign Het
L1td1 A G 4: 98,733,624 K141R possibly damaging Het
Loxhd1 A G 18: 77,402,885 I1394V possibly damaging Het
Lrfn5 A T 12: 61,839,647 M74L probably damaging Het
Lrp6 C T 6: 134,511,267 D289N probably benign Het
Mroh7 A G 4: 106,691,513 probably null Het
Muc4 A C 16: 32,769,277 E2885A possibly damaging Het
Myo18b G T 5: 112,875,175 probably benign Het
Ncln G A 10: 81,493,068 A172V probably damaging Het
Nek9 G A 12: 85,320,892 T335M possibly damaging Het
Notch2 A G 3: 98,135,513 Y1398C probably damaging Het
Olfr472 A T 7: 107,902,981 H88L probably benign Het
Olfr710 T A 7: 106,944,867 I45F probably damaging Het
Olfr981 A T 9: 40,022,527 I45F probably damaging Het
Pax2 G A 19: 44,760,937 V40M probably damaging Het
Pde6c A G 19: 38,169,439 Y637C probably damaging Het
Plppr5 A G 3: 117,620,969 I80V probably damaging Het
Pold1 G T 7: 44,532,809 P1100T probably damaging Het
Prune2 T C 19: 17,000,023 Y41H probably damaging Het
Rgl2 C T 17: 33,933,226 A329V possibly damaging Het
Rilp T A 11: 75,511,424 Y250N probably damaging Het
Rilpl1 A G 5: 124,514,688 V19A probably benign Het
Rtp3 T C 9: 110,986,451 probably null Het
Rufy4 A G 1: 74,133,107 K246E probably damaging Het
Saraf C A 8: 34,168,462 A306E probably damaging Het
Slc26a8 A T 17: 28,638,684 N828K probably benign Het
Src C T 2: 157,469,932 P527S probably damaging Het
Susd3 C T 13: 49,231,302 probably null Het
Syngap1 T C 17: 26,966,906 L1270P probably damaging Het
Taf1c G A 8: 119,598,850 P758S probably damaging Het
Tenm2 A T 11: 36,024,448 N2087K probably damaging Het
Tfrc A T 16: 32,630,151 I703F probably damaging Het
Thap1 C G 8: 26,160,846 T48S probably benign Het
Tspear T C 10: 77,866,329 F199L probably benign Het
Usp17lc A T 7: 103,418,590 H364L probably benign Het
Usp9x A G X: 13,123,508 R776G possibly damaging Homo
Vmn1r1 T C 1: 182,157,224 E292G possibly damaging Het
Vmn1r125 T G 7: 21,272,627 V150G probably damaging Het
Vmn1r167 A T 7: 23,504,692 L300I probably damaging Het
Vmn2r106 A C 17: 20,267,623 I838S probably benign Het
Wdr64 A T 1: 175,726,494 S197C probably damaging Het
Zfp248 A T 6: 118,433,307 V47E possibly damaging Het
Other mutations in Amhr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02273:Amhr2 APN 15 102452489 missense probably benign 0.02
IGL02941:Amhr2 APN 15 102447289 missense probably damaging 1.00
R0269:Amhr2 UTSW 15 102447068 missense probably benign 0.39
R0645:Amhr2 UTSW 15 102446428 missense probably damaging 1.00
R1128:Amhr2 UTSW 15 102452821 missense probably benign 0.10
R1857:Amhr2 UTSW 15 102446777 nonsense probably null
R3500:Amhr2 UTSW 15 102447066 missense probably benign 0.01
R3882:Amhr2 UTSW 15 102445898 missense probably damaging 1.00
R4980:Amhr2 UTSW 15 102454330 missense probably benign 0.00
R5053:Amhr2 UTSW 15 102447258 missense probably damaging 1.00
R7003:Amhr2 UTSW 15 102446333 missense probably benign 0.00
R7016:Amhr2 UTSW 15 102454364 missense possibly damaging 0.63
R7293:Amhr2 UTSW 15 102447393 missense probably benign 0.00
R7636:Amhr2 UTSW 15 102452458 missense probably damaging 1.00
RF014:Amhr2 UTSW 15 102453154 missense probably benign 0.00
X0013:Amhr2 UTSW 15 102452752 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGTGGTGAGACATGCTC -3'
(R):5'- AACAGTGTCGCCTACAGGATC -3'

Sequencing Primer
(F):5'- CTCTTAGCAAGGACTCCGTG -3'
(R):5'- CCTTGCTGAACACTGAGGAGAC -3'
Posted On2015-10-08