Incidental Mutation 'R4661:Slc26a8'
ID352892
Institutional Source Beutler Lab
Gene Symbol Slc26a8
Ensembl Gene ENSMUSG00000036196
Gene Namesolute carrier family 26, member 8
Synonyms
MMRRC Submission 041600-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.304) question?
Stock #R4661 (G1)
Quality Score147
Status Not validated
Chromosome17
Chromosomal Location28637783-28689987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28638684 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 828 (N828K)
Ref Sequence ENSEMBL: ENSMUSP00000110412 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114764]
Predicted Effect probably benign
Transcript: ENSMUST00000114764
AA Change: N828K

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000110412
Gene: ENSMUSG00000036196
AA Change: N828K

DomainStartEndE-ValueType
Pfam:Sulfate_transp 90 491 1.2e-72 PFAM
low complexity region 494 509 N/A INTRINSIC
Pfam:STAS 542 792 7.3e-16 PFAM
low complexity region 881 896 N/A INTRINSIC
low complexity region 923 958 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLC26 gene family of anion transporters. Family members are well conserved in gene structure and protein length yet have markedly different tissue expression patterns. The expression of this gene appears to be restricted to spermatocytes. Alternatively spliced transcript variants that encode different isoforms have been described. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a targeted allele exhibit male sterility associated with sperm immotility, abnormal flagella and reduced acrosomal reaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T C 9: 44,287,330 N42D probably damaging Het
Adamdec1 G A 14: 68,570,113 T366I probably damaging Het
Adamts7 C A 9: 90,193,330 H1038Q probably benign Het
Aff3 T C 1: 38,627,128 D5G possibly damaging Het
Amhr2 A T 15: 102,454,253 D485V probably damaging Het
Arhgap35 A T 7: 16,564,738 F134Y probably damaging Het
Asxl3 A G 18: 22,516,477 T508A probably benign Het
Atp10a TGGCGGCGGC TGGCGGC 7: 58,658,500 probably benign Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Atp9a A G 2: 168,637,672 F928L possibly damaging Het
BC034090 A T 1: 155,232,475 D13E probably damaging Het
Bco1 A G 8: 117,129,241 E425G probably benign Het
Brsk1 T C 7: 4,707,299 S436P possibly damaging Het
C1s1 T C 6: 124,536,490 I193V probably benign Het
Calb2 A G 8: 110,168,077 F21L probably benign Het
Catsperz T G 19: 6,924,803 T108P probably benign Het
Cep57l1 T A 10: 41,719,771 D329V possibly damaging Het
Cfdp1 A G 8: 111,830,945 F188S probably benign Het
Chrna2 G A 14: 66,148,843 G146D probably damaging Het
Col6a1 A C 10: 76,714,672 F520V unknown Het
Cyb5d2 C A 11: 72,778,945 V43L probably damaging Het
Cyp2c40 T C 19: 39,786,846 T321A probably benign Het
Dnajc16 A C 4: 141,763,548 Y764D probably damaging Het
Dsg1a G A 18: 20,340,533 V888M probably damaging Het
F5 A C 1: 164,184,920 T468P probably damaging Het
Faap24 A G 7: 35,395,084 M97T probably benign Het
Fam227b A T 2: 126,007,310 I334N probably damaging Het
Frem2 G T 3: 53,655,443 P548T probably damaging Het
Gfm1 A G 3: 67,433,398 E94G probably damaging Het
Gm17606 A T 14: 54,648,239 probably benign Het
Gnb2 A T 5: 137,530,253 M1K probably null Het
Gys1 G A 7: 45,454,834 A544T probably damaging Het
Hdac5 T C 11: 102,205,849 Y230C probably damaging Het
Hunk A T 16: 90,447,308 probably null Het
Ifnl2 A G 7: 28,510,210 F51L probably damaging Het
Itpr1 T C 6: 108,410,931 probably null Het
Kcnj1 A G 9: 32,396,622 Y114C probably benign Het
Kdm4b T A 17: 56,399,459 S322T probably damaging Het
Kif27 T C 13: 58,323,916 E786G probably damaging Het
Kif6 T C 17: 49,753,881 V414A probably benign Het
L1td1 A G 4: 98,733,624 K141R possibly damaging Het
Loxhd1 A G 18: 77,402,885 I1394V possibly damaging Het
Lrfn5 A T 12: 61,839,647 M74L probably damaging Het
Lrp6 C T 6: 134,511,267 D289N probably benign Het
Mroh7 A G 4: 106,691,513 probably null Het
Muc4 A C 16: 32,769,277 E2885A possibly damaging Het
Myo18b G T 5: 112,875,175 probably benign Het
Ncln G A 10: 81,493,068 A172V probably damaging Het
Nek9 G A 12: 85,320,892 T335M possibly damaging Het
Notch2 A G 3: 98,135,513 Y1398C probably damaging Het
Olfr472 A T 7: 107,902,981 H88L probably benign Het
Olfr710 T A 7: 106,944,867 I45F probably damaging Het
Olfr981 A T 9: 40,022,527 I45F probably damaging Het
Pax2 G A 19: 44,760,937 V40M probably damaging Het
Pde6c A G 19: 38,169,439 Y637C probably damaging Het
Plppr5 A G 3: 117,620,969 I80V probably damaging Het
Pold1 G T 7: 44,532,809 P1100T probably damaging Het
Prune2 T C 19: 17,000,023 Y41H probably damaging Het
Rgl2 C T 17: 33,933,226 A329V possibly damaging Het
Rilp T A 11: 75,511,424 Y250N probably damaging Het
Rilpl1 A G 5: 124,514,688 V19A probably benign Het
Rtp3 T C 9: 110,986,451 probably null Het
Rufy4 A G 1: 74,133,107 K246E probably damaging Het
Saraf C A 8: 34,168,462 A306E probably damaging Het
Src C T 2: 157,469,932 P527S probably damaging Het
Susd3 C T 13: 49,231,302 probably null Het
Syngap1 T C 17: 26,966,906 L1270P probably damaging Het
Taf1c G A 8: 119,598,850 P758S probably damaging Het
Tenm2 A T 11: 36,024,448 N2087K probably damaging Het
Tfrc A T 16: 32,630,151 I703F probably damaging Het
Thap1 C G 8: 26,160,846 T48S probably benign Het
Tspear T C 10: 77,866,329 F199L probably benign Het
Usp17lc A T 7: 103,418,590 H364L probably benign Het
Usp9x A G X: 13,123,508 R776G possibly damaging Homo
Vmn1r1 T C 1: 182,157,224 E292G possibly damaging Het
Vmn1r125 T G 7: 21,272,627 V150G probably damaging Het
Vmn1r167 A T 7: 23,504,692 L300I probably damaging Het
Vmn2r106 A C 17: 20,267,623 I838S probably benign Het
Wdr64 A T 1: 175,726,494 S197C probably damaging Het
Zfp248 A T 6: 118,433,307 V47E possibly damaging Het
Other mutations in Slc26a8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01466:Slc26a8 APN 17 28654948 missense probably benign 0.01
IGL02041:Slc26a8 APN 17 28642251 missense probably damaging 1.00
IGL02389:Slc26a8 APN 17 28638650 missense probably benign 0.00
E0370:Slc26a8 UTSW 17 28642387 missense possibly damaging 0.77
FR4449:Slc26a8 UTSW 17 28638316 small deletion probably benign
R1028:Slc26a8 UTSW 17 28672798 missense probably damaging 1.00
R1445:Slc26a8 UTSW 17 28648213 missense possibly damaging 0.72
R1501:Slc26a8 UTSW 17 28638562 missense possibly damaging 0.73
R1606:Slc26a8 UTSW 17 28638481 missense possibly damaging 0.73
R1819:Slc26a8 UTSW 17 28684834 missense probably benign 0.31
R1950:Slc26a8 UTSW 17 28644640 missense probably benign 0.06
R1973:Slc26a8 UTSW 17 28663605 missense probably benign 0.01
R2203:Slc26a8 UTSW 17 28648007 missense probably benign 0.06
R3912:Slc26a8 UTSW 17 28644779 missense possibly damaging 0.92
R4176:Slc26a8 UTSW 17 28647999 missense probably benign 0.04
R4539:Slc26a8 UTSW 17 28659617 missense probably benign 0.00
R4766:Slc26a8 UTSW 17 28638661 missense probably benign 0.01
R4850:Slc26a8 UTSW 17 28654883 missense probably benign 0.01
R4867:Slc26a8 UTSW 17 28663634 missense probably benign 0.05
R5521:Slc26a8 UTSW 17 28654859 missense probably benign 0.10
R5713:Slc26a8 UTSW 17 28661879 missense probably benign 0.01
R6092:Slc26a8 UTSW 17 28648155 missense probably damaging 1.00
R6135:Slc26a8 UTSW 17 28669940 missense probably benign 0.00
R6372:Slc26a8 UTSW 17 28644803 missense probably benign 0.08
R6543:Slc26a8 UTSW 17 28638401 missense possibly damaging 0.53
R6590:Slc26a8 UTSW 17 28644655 missense possibly damaging 0.52
R6690:Slc26a8 UTSW 17 28644655 missense possibly damaging 0.52
R6866:Slc26a8 UTSW 17 28638481 missense probably benign 0.27
R7057:Slc26a8 UTSW 17 28638397 missense possibly damaging 0.72
R7423:Slc26a8 UTSW 17 28648203 missense probably benign 0.32
R7496:Slc26a8 UTSW 17 28644850 missense probably benign 0.20
RF015:Slc26a8 UTSW 17 28638341 small deletion probably benign
Z1177:Slc26a8 UTSW 17 28638165 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GATTGAGGTCCATCCCACTG -3'
(R):5'- CAGGCTTGCCTACTTGGAAG -3'

Sequencing Primer
(F):5'- CTGCTCTGTTCAAAAGACAGCATGG -3'
(R):5'- CCAAGACAGGGTTTCTCTGTG -3'
Posted On2015-10-08