Incidental Mutation 'R4661:Rgl2'
ID 352893
Institutional Source Beutler Lab
Gene Symbol Rgl2
Ensembl Gene ENSMUSG00000041354
Gene Name ral guanine nucleotide dissociation stimulator-like 2
Synonyms Rlf, Rgt2, Rab2l, KE1.5
MMRRC Submission 041600-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.136) question?
Stock # R4661 (G1)
Quality Score 225
Status Not validated
Chromosome 17
Chromosomal Location 34148813-34156661 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 34152200 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Valine at position 329 (A329V)
Ref Sequence ENSEMBL: ENSMUSP00000041082 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025161] [ENSMUST00000047503]
AlphaFold Q61193
PDB Structure STRUCTURE DETERMINATION OF THE RAS-BINDING DOMAIN OF THE RAL-SPECIFIC GUANINE NUCLEOTIDE EXCHANGE FACTOR RLF, NMR, 10 STRUCTURES [SOLUTION NMR]
The conformation of a docking site for SH3 domains is pre-selected in the Guanine Nucleotide Exchange Factor Rlf [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000025161
SMART Domains Protein: ENSMUSP00000025161
Gene: ENSMUSG00000024308

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 48 65 N/A INTRINSIC
low complexity region 127 152 N/A INTRINSIC
IG 168 292 3.45e0 SMART
IG_like 302 406 4.78e1 SMART
transmembrane domain 416 438 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000047503
AA Change: A329V

PolyPhen 2 Score 0.772 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354
AA Change: A329V

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172468
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172653
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173258
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173266
Predicted Effect probably benign
Transcript: ENSMUST00000173284
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173379
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174676
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174442
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173718
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 T C 9: 44,198,627 (GRCm39) N42D probably damaging Het
Adamdec1 G A 14: 68,807,562 (GRCm39) T366I probably damaging Het
Adamts7 C A 9: 90,075,383 (GRCm39) H1038Q probably benign Het
Aff3 T C 1: 38,666,209 (GRCm39) D5G possibly damaging Het
Amhr2 A T 15: 102,362,688 (GRCm39) D485V probably damaging Het
Arhgap35 A T 7: 16,298,663 (GRCm39) F134Y probably damaging Het
Asxl3 A G 18: 22,649,534 (GRCm39) T508A probably benign Het
Atp10a TGGCGGCGGC TGGCGGC 7: 58,308,248 (GRCm39) probably benign Het
Atp4a G A 7: 30,419,650 (GRCm39) R671Q probably benign Het
Atp9a A G 2: 168,479,592 (GRCm39) F928L possibly damaging Het
BC034090 A T 1: 155,108,221 (GRCm39) D13E probably damaging Het
Bco1 A G 8: 117,855,980 (GRCm39) E425G probably benign Het
Brsk1 T C 7: 4,710,298 (GRCm39) S436P possibly damaging Het
C1s1 T C 6: 124,513,449 (GRCm39) I193V probably benign Het
Calb2 A G 8: 110,894,709 (GRCm39) F21L probably benign Het
Catsperz T G 19: 6,902,171 (GRCm39) T108P probably benign Het
Cep57l1 T A 10: 41,595,767 (GRCm39) D329V possibly damaging Het
Cfdp1 A G 8: 112,557,577 (GRCm39) F188S probably benign Het
Chrna2 G A 14: 66,386,292 (GRCm39) G146D probably damaging Het
Col6a1 A C 10: 76,550,506 (GRCm39) F520V unknown Het
Cyb5d2 C A 11: 72,669,771 (GRCm39) V43L probably damaging Het
Cyp2c40 T C 19: 39,775,290 (GRCm39) T321A probably benign Het
Dnajc16 A C 4: 141,490,859 (GRCm39) Y764D probably damaging Het
Dsg1a G A 18: 20,473,590 (GRCm39) V888M probably damaging Het
F5 A C 1: 164,012,489 (GRCm39) T468P probably damaging Het
Faap24 A G 7: 35,094,509 (GRCm39) M97T probably benign Het
Fam227b A T 2: 125,849,230 (GRCm39) I334N probably damaging Het
Frem2 G T 3: 53,562,864 (GRCm39) P548T probably damaging Het
Gfm1 A G 3: 67,340,731 (GRCm39) E94G probably damaging Het
Gm17606 A T 14: 54,885,696 (GRCm39) probably benign Het
Gnb2 A T 5: 137,528,515 (GRCm39) M1K probably null Het
Gys1 G A 7: 45,104,258 (GRCm39) A544T probably damaging Het
Hdac5 T C 11: 102,096,675 (GRCm39) Y230C probably damaging Het
Hunk A T 16: 90,244,196 (GRCm39) probably null Het
Ifnl2 A G 7: 28,209,635 (GRCm39) F51L probably damaging Het
Itpr1 T C 6: 108,387,892 (GRCm39) probably null Het
Kcnj1 A G 9: 32,307,918 (GRCm39) Y114C probably benign Het
Kdm4b T A 17: 56,706,459 (GRCm39) S322T probably damaging Het
Kif27 T C 13: 58,471,730 (GRCm39) E786G probably damaging Het
Kif6 T C 17: 50,060,909 (GRCm39) V414A probably benign Het
L1td1 A G 4: 98,621,861 (GRCm39) K141R possibly damaging Het
Loxhd1 A G 18: 77,490,581 (GRCm39) I1394V possibly damaging Het
Lrfn5 A T 12: 61,886,433 (GRCm39) M74L probably damaging Het
Lrp6 C T 6: 134,488,230 (GRCm39) D289N probably benign Het
Mroh7 A G 4: 106,548,710 (GRCm39) probably null Het
Muc4 A C 16: 32,589,651 (GRCm39) E2885A possibly damaging Het
Myo18b G T 5: 113,023,041 (GRCm39) probably benign Het
Ncln G A 10: 81,328,902 (GRCm39) A172V probably damaging Het
Nek9 G A 12: 85,367,666 (GRCm39) T335M possibly damaging Het
Notch2 A G 3: 98,042,829 (GRCm39) Y1398C probably damaging Het
Or10g6 A T 9: 39,933,823 (GRCm39) I45F probably damaging Het
Or2d4 T A 7: 106,544,074 (GRCm39) I45F probably damaging Het
Or5p52 A T 7: 107,502,188 (GRCm39) H88L probably benign Het
Pax2 G A 19: 44,749,376 (GRCm39) V40M probably damaging Het
Pde6c A G 19: 38,157,887 (GRCm39) Y637C probably damaging Het
Plppr5 A G 3: 117,414,618 (GRCm39) I80V probably damaging Het
Pold1 G T 7: 44,182,233 (GRCm39) P1100T probably damaging Het
Prune2 T C 19: 16,977,387 (GRCm39) Y41H probably damaging Het
Rilp T A 11: 75,402,250 (GRCm39) Y250N probably damaging Het
Rilpl1 A G 5: 124,652,751 (GRCm39) V19A probably benign Het
Rtp3 T C 9: 110,815,519 (GRCm39) probably null Het
Rufy4 A G 1: 74,172,266 (GRCm39) K246E probably damaging Het
Saraf C A 8: 34,635,616 (GRCm39) A306E probably damaging Het
Slc26a8 A T 17: 28,857,658 (GRCm39) N828K probably benign Het
Src C T 2: 157,311,852 (GRCm39) P527S probably damaging Het
Susd3 C T 13: 49,384,778 (GRCm39) probably null Het
Syngap1 T C 17: 27,185,880 (GRCm39) L1270P probably damaging Het
Taf1c G A 8: 120,325,589 (GRCm39) P758S probably damaging Het
Tenm2 A T 11: 35,915,275 (GRCm39) N2087K probably damaging Het
Tfrc A T 16: 32,448,969 (GRCm39) I703F probably damaging Het
Thap1 C G 8: 26,650,874 (GRCm39) T48S probably benign Het
Tspear T C 10: 77,702,163 (GRCm39) F199L probably benign Het
Usp17lc A T 7: 103,067,797 (GRCm39) H364L probably benign Het
Usp9x A G X: 12,989,747 (GRCm39) R776G possibly damaging Homo
Vmn1r1 T C 1: 181,984,789 (GRCm39) E292G possibly damaging Het
Vmn1r125 T G 7: 21,006,552 (GRCm39) V150G probably damaging Het
Vmn1r167 A T 7: 23,204,117 (GRCm39) L300I probably damaging Het
Vmn2r106 A C 17: 20,487,885 (GRCm39) I838S probably benign Het
Wdr64 A T 1: 175,554,060 (GRCm39) S197C probably damaging Het
Zfp248 A T 6: 118,410,268 (GRCm39) V47E possibly damaging Het
Other mutations in Rgl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Rgl2 APN 17 34,152,110 (GRCm39) missense probably benign 0.31
IGL00898:Rgl2 APN 17 34,152,392 (GRCm39) missense possibly damaging 0.95
IGL00965:Rgl2 APN 17 34,154,910 (GRCm39) missense probably benign 0.00
IGL00985:Rgl2 APN 17 34,151,075 (GRCm39) missense probably damaging 1.00
IGL02140:Rgl2 APN 17 34,152,098 (GRCm39) missense probably damaging 1.00
IGL02214:Rgl2 APN 17 34,154,163 (GRCm39) missense probably benign 0.06
IGL02486:Rgl2 APN 17 34,154,954 (GRCm39) missense probably damaging 0.97
IGL02579:Rgl2 APN 17 34,156,134 (GRCm39) missense probably benign 0.08
IGL02976:Rgl2 APN 17 34,152,936 (GRCm39) missense possibly damaging 0.95
Hypotenuse UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
Pedernales UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
PIT4354001:Rgl2 UTSW 17 34,152,914 (GRCm39) missense possibly damaging 0.80
R0347:Rgl2 UTSW 17 34,151,712 (GRCm39) missense probably damaging 1.00
R0456:Rgl2 UTSW 17 34,155,823 (GRCm39) splice site probably null
R0825:Rgl2 UTSW 17 34,154,133 (GRCm39) splice site probably null
R1742:Rgl2 UTSW 17 34,156,197 (GRCm39) splice site probably null
R1777:Rgl2 UTSW 17 34,150,718 (GRCm39) missense probably benign 0.00
R1829:Rgl2 UTSW 17 34,152,595 (GRCm39) missense probably benign 0.00
R1908:Rgl2 UTSW 17 34,151,122 (GRCm39) missense probably benign 0.00
R1961:Rgl2 UTSW 17 34,152,589 (GRCm39) missense probably damaging 1.00
R2102:Rgl2 UTSW 17 34,152,314 (GRCm39) splice site probably null
R3001:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3002:Rgl2 UTSW 17 34,151,579 (GRCm39) missense probably benign 0.00
R3755:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3756:Rgl2 UTSW 17 34,151,571 (GRCm39) missense probably benign 0.01
R3978:Rgl2 UTSW 17 34,154,136 (GRCm39) missense probably benign 0.02
R4042:Rgl2 UTSW 17 34,156,236 (GRCm39) missense probably damaging 1.00
R4064:Rgl2 UTSW 17 34,156,082 (GRCm39) missense possibly damaging 0.77
R4204:Rgl2 UTSW 17 34,155,906 (GRCm39) missense probably benign 0.04
R4852:Rgl2 UTSW 17 34,156,147 (GRCm39) missense probably benign 0.00
R4922:Rgl2 UTSW 17 34,151,749 (GRCm39) unclassified probably benign
R5119:Rgl2 UTSW 17 34,156,094 (GRCm39) missense probably benign 0.00
R5167:Rgl2 UTSW 17 34,154,948 (GRCm39) nonsense probably null
R5279:Rgl2 UTSW 17 34,154,922 (GRCm39) missense probably benign
R5319:Rgl2 UTSW 17 34,152,529 (GRCm39) missense probably benign 0.02
R5337:Rgl2 UTSW 17 34,153,958 (GRCm39) missense probably damaging 0.99
R5881:Rgl2 UTSW 17 34,151,691 (GRCm39) missense probably benign 0.01
R5945:Rgl2 UTSW 17 34,151,012 (GRCm39) critical splice acceptor site probably null
R6165:Rgl2 UTSW 17 34,150,739 (GRCm39) missense probably benign 0.01
R6358:Rgl2 UTSW 17 34,156,105 (GRCm39) splice site probably null
R6867:Rgl2 UTSW 17 34,151,661 (GRCm39) missense probably benign 0.09
R7174:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7182:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7183:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7184:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7196:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7203:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7250:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7253:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7254:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7255:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7256:Rgl2 UTSW 17 34,153,964 (GRCm39) missense possibly damaging 0.93
R7282:Rgl2 UTSW 17 34,152,403 (GRCm39) missense probably damaging 1.00
R7455:Rgl2 UTSW 17 34,151,657 (GRCm39) missense probably benign 0.32
R7513:Rgl2 UTSW 17 34,151,529 (GRCm39) missense probably benign
R7752:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7901:Rgl2 UTSW 17 34,154,799 (GRCm39) missense possibly damaging 0.82
R7941:Rgl2 UTSW 17 34,150,713 (GRCm39) missense probably benign 0.00
R8158:Rgl2 UTSW 17 34,155,918 (GRCm39) missense probably benign 0.27
R8209:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8226:Rgl2 UTSW 17 34,151,501 (GRCm39) missense possibly damaging 0.91
R8405:Rgl2 UTSW 17 34,152,698 (GRCm39) nonsense probably null
R8871:Rgl2 UTSW 17 34,153,974 (GRCm39) missense probably damaging 1.00
R9205:Rgl2 UTSW 17 34,155,002 (GRCm39) missense probably damaging 1.00
R9591:Rgl2 UTSW 17 34,151,451 (GRCm39) missense possibly damaging 0.50
X0028:Rgl2 UTSW 17 34,151,432 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- ATCCCCTCTCAGTGTTTGGG -3'
(R):5'- AAGAACAGGCCTCTGAGCAC -3'

Sequencing Primer
(F):5'- CTCAGTGTTTGGGAGGCCTC -3'
(R):5'- TGGCGTTCCGAAGCTTC -3'
Posted On 2015-10-08