Incidental Mutation 'R0271:Pcsk9'
ID35290
Institutional Source Beutler Lab
Gene Symbol Pcsk9
Ensembl Gene ENSMUSG00000044254
Gene Nameproprotein convertase subtilisin/kexin type 9
SynonymsNarc1
MMRRC Submission 038497-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0271 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location106442329-106464329 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 106449049 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000055757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049507]
Predicted Effect probably benign
Transcript: ENSMUST00000049507
SMART Domains Protein: ENSMUSP00000055757
Gene: ENSMUSG00000044254

DomainStartEndE-ValueType
low complexity region 12 27 N/A INTRINSIC
Pfam:Peptidase_S8 180 438 3.1e-34 PFAM
low complexity region 471 481 N/A INTRINSIC
low complexity region 490 500 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The encoded protein undergoes an autocatalytic processing event with its prosegment in the ER and is constitutively secreted as an inactive protease into the extracellular matrix and trans-Golgi network. It is expressed in liver, intestine and kidney tissues and escorts specific receptors for lysosomal degradation. It plays a role in cholesterol and fatty acid metabolism. Mutations in this gene have been associated with autosomal dominant familial hypercholesterolemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Homozygous null mice exhibit increased clearance of circulating cholesterol and decreased plasma cholesterol levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,686,329 probably benign Het
4930544D05Rik A G 11: 70,616,648 Q173R possibly damaging Het
Ampd2 C T 3: 108,086,716 probably benign Het
Ankrd17 T C 5: 90,254,799 S1467G possibly damaging Het
Arhgap31 T G 16: 38,602,510 S1065R possibly damaging Het
Arhgef19 G T 4: 141,250,607 M542I probably benign Het
C7 T C 15: 5,015,380 D392G possibly damaging Het
Ccdc138 G A 10: 58,575,823 C671Y probably damaging Het
Cdh8 A G 8: 99,111,715 S498P possibly damaging Het
Cpb2 T A 14: 75,257,709 probably null Het
Cwc22 A C 2: 77,920,858 N389K probably benign Het
Dgkb T A 12: 38,228,026 L550Q probably damaging Het
Dip2c A G 13: 9,615,775 R950G probably damaging Het
Eml6 A G 11: 29,848,949 V437A possibly damaging Het
Fanca T C 8: 123,272,441 probably benign Het
Fgd2 C G 17: 29,367,008 L189V possibly damaging Het
Foxred2 A C 15: 77,943,390 S590A possibly damaging Het
Gm1110 A G 9: 26,920,666 F63S probably damaging Het
Gm14496 A T 2: 181,995,954 M274L probably benign Het
Gm7008 T A 12: 40,223,560 probably benign Het
Gm9922 T A 14: 101,729,553 probably benign Het
Gtf3c3 A T 1: 54,428,812 M222K possibly damaging Het
Hspa1b A G 17: 34,958,832 V59A probably benign Het
Impg1 T C 9: 80,386,879 probably benign Het
Lpcat4 T A 2: 112,243,245 probably null Het
Mipol1 T C 12: 57,460,954 probably benign Het
Mrpl37 C A 4: 107,066,461 R112L possibly damaging Het
Myo18b T C 5: 112,809,685 N1471D possibly damaging Het
Nes G A 3: 87,978,642 E1359K possibly damaging Het
Nipbl A T 15: 8,361,737 V251E possibly damaging Het
Nlrp1b T C 11: 71,161,765 I946V possibly damaging Het
Obscn T G 11: 59,056,742 probably benign Het
Olfr1024 A T 2: 85,904,289 M255K possibly damaging Het
Olfr1239 T A 2: 89,418,158 Y85F probably benign Het
Olfr1491 A T 19: 13,705,135 T103S probably benign Het
Olfr635 T A 7: 103,979,630 I146K possibly damaging Het
Pck2 T C 14: 55,544,584 probably null Het
Phyhd1 A T 2: 30,269,822 Q56L probably benign Het
Plxnc1 C T 10: 94,837,918 G1001S probably null Het
Prss52 T C 14: 64,113,678 V304A probably benign Het
Prss55 C T 14: 64,075,607 G276D probably benign Het
Pzp A T 6: 128,519,514 Y252N probably damaging Het
Rad1 T C 15: 10,490,457 probably null Het
Ripply3 A T 16: 94,335,757 E92D possibly damaging Het
Rpp30 T A 19: 36,104,403 D255E probably benign Het
Rsad1 T C 11: 94,548,464 probably benign Het
Serpini2 A G 3: 75,246,578 M358T probably damaging Het
Slc35a1 T A 4: 34,664,125 E331V probably benign Het
Slc38a7 A G 8: 95,845,878 F179L probably damaging Het
Stmn4 C T 14: 66,356,283 Q42* probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tab2 G A 10: 7,919,158 A520V probably benign Het
Tcp10a A G 17: 7,331,156 I162M probably benign Het
Tmprss13 A G 9: 45,333,688 probably benign Het
Tnfrsf14 A G 4: 154,926,597 probably null Het
Tpx2 A G 2: 152,867,367 probably benign Het
Vmn2r105 T A 17: 20,234,703 N57I probably damaging Het
Wars C T 12: 108,875,193 V220I probably benign Het
Washc1 T A 17: 66,116,719 D212E possibly damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Wdr43 A G 17: 71,626,825 D139G probably benign Het
Zfp235 A T 7: 24,137,131 H34L possibly damaging Het
Zkscan16 G A 4: 58,952,391 V230I probably benign Het
Other mutations in Pcsk9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02140:Pcsk9 APN 4 106454646 missense probably benign 0.00
IGL02709:Pcsk9 APN 4 106447689 splice site probably benign
IGL02804:Pcsk9 APN 4 106456964 missense probably damaging 1.00
IGL02850:Pcsk9 APN 4 106458865 missense probably damaging 1.00
IGL03009:Pcsk9 APN 4 106454345 missense probably damaging 1.00
IGL03294:Pcsk9 APN 4 106446770 missense probably benign
R0321:Pcsk9 UTSW 4 106444694 missense probably benign
R0413:Pcsk9 UTSW 4 106454341 missense probably damaging 1.00
R0426:Pcsk9 UTSW 4 106450077 missense possibly damaging 0.77
R0783:Pcsk9 UTSW 4 106450117 missense probably benign 0.00
R2136:Pcsk9 UTSW 4 106446770 missense probably benign 0.00
R4056:Pcsk9 UTSW 4 106444702 missense probably benign 0.02
R4438:Pcsk9 UTSW 4 106458959 missense probably benign 0.00
R4683:Pcsk9 UTSW 4 106458895 missense possibly damaging 0.59
R4739:Pcsk9 UTSW 4 106447156 missense probably damaging 1.00
R4801:Pcsk9 UTSW 4 106447569 missense probably benign 0.43
R4802:Pcsk9 UTSW 4 106447569 missense probably benign 0.43
R5249:Pcsk9 UTSW 4 106463753 missense probably benign 0.01
R5307:Pcsk9 UTSW 4 106447174 missense probably damaging 1.00
R5320:Pcsk9 UTSW 4 106463791 missense probably benign 0.00
R5653:Pcsk9 UTSW 4 106458916 missense probably damaging 1.00
R5827:Pcsk9 UTSW 4 106448947 missense probably damaging 1.00
R6010:Pcsk9 UTSW 4 106454272 missense possibly damaging 0.92
R6019:Pcsk9 UTSW 4 106456876 missense probably benign 0.02
R6393:Pcsk9 UTSW 4 106447596 missense probably benign 0.00
R7472:Pcsk9 UTSW 4 106458897 missense probably benign 0.08
R7614:Pcsk9 UTSW 4 106447566 missense probably benign 0.34
R7807:Pcsk9 UTSW 4 106463895 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- TGAGGTCCCACTCTGTGACATGAAG -3'
(R):5'- AGAGCATCTGCTATGCAGTGAACG -3'

Sequencing Primer
(F):5'- CCAAAGTCCCCAAGGTAACT -3'
(R):5'- ATGCAGCTTGATAGTAGGCCC -3'
Posted On2013-05-09