Incidental Mutation 'R0271:Mrpl37'
ID35291
Institutional Source Beutler Lab
Gene Symbol Mrpl37
Ensembl Gene ENSMUSG00000028622
Gene Namemitochondrial ribosomal protein L37
Synonyms2300004O14Rik, MRP-L2, Rpml2
MMRRC Submission 038497-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.955) question?
Stock #R0271 (G1)
Quality Score188
Status Validated
Chromosome4
Chromosomal Location107055874-107066868 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 107066461 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 112 (R112L)
Ref Sequence ENSEMBL: ENSMUSP00000030365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030364] [ENSMUST00000030365] [ENSMUST00000106756] [ENSMUST00000106758] [ENSMUST00000106760] [ENSMUST00000137269] [ENSMUST00000145324] [ENSMUST00000149453] [ENSMUST00000154283]
Predicted Effect probably benign
Transcript: ENSMUST00000030364
SMART Domains Protein: ENSMUSP00000030364
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 15 56 1e-10 PFAM
Pfam:FAD_binding_6 80 156 2.3e-11 PFAM
Pfam:NAD_binding_1 152 266 1.8e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000030365
AA Change: R112L

PolyPhen 2 Score 0.795 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030365
Gene: ENSMUSG00000028622
AA Change: R112L

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Pfam:PDCD9 292 420 6.4e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106756
SMART Domains Protein: ENSMUSP00000102367
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
Pfam:FAD_binding_6 20 117 4.7e-23 PFAM
Pfam:NAD_binding_1 127 241 3.2e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106758
SMART Domains Protein: ENSMUSP00000102369
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
Pfam:Oxidored-like 10 55 1.7e-15 PFAM
Pfam:FAD_binding_6 80 177 8.2e-25 PFAM
Pfam:NAD_binding_1 187 301 8.8e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106760
SMART Domains Protein: ENSMUSP00000102371
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 15 56 2.5e-14 PFAM
Pfam:FAD_binding_6 80 156 3.1e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125157
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125397
Predicted Effect probably benign
Transcript: ENSMUST00000126207
SMART Domains Protein: ENSMUSP00000116114
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
Pfam:Oxidored-like 4 49 1.3e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137269
SMART Domains Protein: ENSMUSP00000119249
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
Pfam:FAD_binding_6 13 110 7.3e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138788
Predicted Effect probably benign
Transcript: ENSMUST00000145324
SMART Domains Protein: ENSMUSP00000122502
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 14 56 3.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149453
SMART Domains Protein: ENSMUSP00000121581
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 14 56 5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154283
SMART Domains Protein: ENSMUSP00000119366
Gene: ENSMUSG00000028621

DomainStartEndE-ValueType
low complexity region 3 11 N/A INTRINSIC
Pfam:Oxidored-like 14 56 4.5e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156406
Meta Mutation Damage Score 0.3156 question?
Coding Region Coverage
  • 1x: 98.5%
  • 3x: 97.4%
  • 10x: 95.2%
  • 20x: 90.6%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,686,329 probably benign Het
4930544D05Rik A G 11: 70,616,648 Q173R possibly damaging Het
Ampd2 C T 3: 108,086,716 probably benign Het
Ankrd17 T C 5: 90,254,799 S1467G possibly damaging Het
Arhgap31 T G 16: 38,602,510 S1065R possibly damaging Het
Arhgef19 G T 4: 141,250,607 M542I probably benign Het
C7 T C 15: 5,015,380 D392G possibly damaging Het
Ccdc138 G A 10: 58,575,823 C671Y probably damaging Het
Cdh8 A G 8: 99,111,715 S498P possibly damaging Het
Cpb2 T A 14: 75,257,709 probably null Het
Cwc22 A C 2: 77,920,858 N389K probably benign Het
Dgkb T A 12: 38,228,026 L550Q probably damaging Het
Dip2c A G 13: 9,615,775 R950G probably damaging Het
Eml6 A G 11: 29,848,949 V437A possibly damaging Het
Fanca T C 8: 123,272,441 probably benign Het
Fgd2 C G 17: 29,367,008 L189V possibly damaging Het
Foxred2 A C 15: 77,943,390 S590A possibly damaging Het
Gm1110 A G 9: 26,920,666 F63S probably damaging Het
Gm14496 A T 2: 181,995,954 M274L probably benign Het
Gm7008 T A 12: 40,223,560 probably benign Het
Gm9922 T A 14: 101,729,553 probably benign Het
Gtf3c3 A T 1: 54,428,812 M222K possibly damaging Het
Hspa1b A G 17: 34,958,832 V59A probably benign Het
Impg1 T C 9: 80,386,879 probably benign Het
Lpcat4 T A 2: 112,243,245 probably null Het
Mipol1 T C 12: 57,460,954 probably benign Het
Myo18b T C 5: 112,809,685 N1471D possibly damaging Het
Nes G A 3: 87,978,642 E1359K possibly damaging Het
Nipbl A T 15: 8,361,737 V251E possibly damaging Het
Nlrp1b T C 11: 71,161,765 I946V possibly damaging Het
Obscn T G 11: 59,056,742 probably benign Het
Olfr1024 A T 2: 85,904,289 M255K possibly damaging Het
Olfr1239 T A 2: 89,418,158 Y85F probably benign Het
Olfr1491 A T 19: 13,705,135 T103S probably benign Het
Olfr635 T A 7: 103,979,630 I146K possibly damaging Het
Pck2 T C 14: 55,544,584 probably null Het
Pcsk9 A G 4: 106,449,049 probably benign Het
Phyhd1 A T 2: 30,269,822 Q56L probably benign Het
Plxnc1 C T 10: 94,837,918 G1001S probably null Het
Prss52 T C 14: 64,113,678 V304A probably benign Het
Prss55 C T 14: 64,075,607 G276D probably benign Het
Pzp A T 6: 128,519,514 Y252N probably damaging Het
Rad1 T C 15: 10,490,457 probably null Het
Ripply3 A T 16: 94,335,757 E92D possibly damaging Het
Rpp30 T A 19: 36,104,403 D255E probably benign Het
Rsad1 T C 11: 94,548,464 probably benign Het
Serpini2 A G 3: 75,246,578 M358T probably damaging Het
Slc35a1 T A 4: 34,664,125 E331V probably benign Het
Slc38a7 A G 8: 95,845,878 F179L probably damaging Het
Stmn4 C T 14: 66,356,283 Q42* probably null Het
Sytl2 T C 7: 90,403,020 probably benign Het
Tab2 G A 10: 7,919,158 A520V probably benign Het
Tcp10a A G 17: 7,331,156 I162M probably benign Het
Tmprss13 A G 9: 45,333,688 probably benign Het
Tnfrsf14 A G 4: 154,926,597 probably null Het
Tpx2 A G 2: 152,867,367 probably benign Het
Vmn2r105 T A 17: 20,234,703 N57I probably damaging Het
Wars C T 12: 108,875,193 V220I probably benign Het
Washc1 T A 17: 66,116,719 D212E possibly damaging Het
Wdr17 C T 8: 54,693,096 A90T possibly damaging Het
Wdr43 A G 17: 71,626,825 D139G probably benign Het
Zfp235 A T 7: 24,137,131 H34L possibly damaging Het
Zkscan16 G A 4: 58,952,391 V230I probably benign Het
Other mutations in Mrpl37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02292:Mrpl37 APN 4 107060532 missense probably damaging 0.96
IGL02451:Mrpl37 APN 4 107066642 missense probably damaging 1.00
R0088:Mrpl37 UTSW 4 107064424 missense possibly damaging 0.65
R1445:Mrpl37 UTSW 4 107064495 missense probably benign 0.00
R2566:Mrpl37 UTSW 4 107064493 missense possibly damaging 0.95
R4751:Mrpl37 UTSW 4 107057475 missense probably damaging 1.00
R5088:Mrpl37 UTSW 4 107064722 missense probably damaging 1.00
R5664:Mrpl37 UTSW 4 107064391 missense probably benign 0.06
R5870:Mrpl37 UTSW 4 107066722 missense probably benign
R5996:Mrpl37 UTSW 4 107066507 missense probably benign
R6163:Mrpl37 UTSW 4 107064596 missense possibly damaging 0.94
R7287:Mrpl37 UTSW 4 107060520 missense probably damaging 1.00
X0067:Mrpl37 UTSW 4 107066479 missense possibly damaging 0.93
Z1176:Mrpl37 UTSW 4 107057426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCAGAAAAGGAGCGTTGTAGAC -3'
(R):5'- CATTACCTACGAGGGCAAGAAGCAC -3'

Sequencing Primer
(F):5'- AGCGTTGTAGACCTGCTTTATTATC -3'
(R):5'- AAGAAGCACTTCGTCCCGTG -3'
Posted On2013-05-09