Mutagenetix > Incidental Mutations

Incidental Mutation 'R4662:Trpm2'

352939

Institutional Source

Beutler Lab

Gene Symbol

Trpm2

Ensembl Gene

ENSMUSG00000009292

Gene Name

transient receptor potential cation channel, subfamily M, member 2

Synonyms

LTRPC2, 9830168K16Rik, TRPC7, Trrp7

MMRRC Submission

042011-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.141) question?

Stock #

R4662 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

77907722-77970563 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to C at 77938138 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Glycine at position 481 (A481G)

Ref Sequence

ENSEMBL: ENSMUSP00000101040 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105401]

AlphaFold

Q91YD4

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000105400

Predicted Effect

probably benign
Transcript: ENSMUST00000105401
AA Change: A481G

PolyPhen 2 Score 0.055 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000101040
Gene: ENSMUSG00000009292
AA Change: A481G

Domain	Start	End	E-Value	Type
low complexity region	654	672	N/A	INTRINSIC
transmembrane domain	750	772	N/A	INTRINSIC
Pfam:Ion_trans	794	1057	3.7e-21	PFAM
low complexity region	1078	1090	N/A	INTRINSIC
low complexity region	1106	1115	N/A	INTRINSIC
low complexity region	1123	1146	N/A	INTRINSIC
PDB:1QVJ\|A	1236	1506	3e-37	PDB
SCOP:d1k2ea_	1369	1502	9e-10	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126206

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene forms a tetrameric cation channel that is permeable to calcium, sodium, and potassium and is regulated by free intracellular ADP-ribose. The encoded protein is activated by oxidative stress and confers susceptibility to cell death. Alternative splicing results in multiple transcript variants encoding distinct protein isoforms. Additional transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired reactive oxygen species (ROS)-induced chemokine production in monocytes, and reduced neutrophil infiltration and ulceration in a dextran sulfate sodium-induced colitis inflammation model. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	T	6: 91,914,958	Q67L	probably benign	Het
8030462N17Rik	T	A	18: 77,674,490	Q42L	probably benign	Het
Adrb1	A	G	19: 56,722,774	T135A	probably damaging	Het
Asxl2	G	T	12: 3,427,193	W13L	probably damaging	Het
Atp4a	G	A	7: 30,720,225	R671Q	probably benign	Het
Brsk1	T	C	7: 4,707,299	S436P	possibly damaging	Het
Calb2	A	G	8: 110,168,077	F21L	probably benign	Het
Camk2a	T	C	18: 60,941,339	Y39H	probably damaging	Het
Cavin2	T	C	1: 51,301,351	S396P	probably benign	Het
Cfdp1	A	G	8: 111,830,945	F188S	probably benign	Het
Chek2	T	A	5: 110,867,042	V459D	probably damaging	Het
Cldn8	G	A	16: 88,562,408	H210Y	probably benign	Het
Cobl	A	G	11: 12,253,672	V1003A	probably benign	Het
Ctsll3	A	G	13: 60,799,602	F257L	possibly damaging	Het
Dnajc13	A	C	9: 104,207,758	F819V	probably damaging	Het
Dram1	C	A	10: 88,325,384	V208L	probably damaging	Het
Dynlt1b	A	G	17: 6,431,880	T10A	probably benign	Het
Eml6	A	T	11: 29,777,390	V1244E	probably damaging	Het
Ethe1	G	A	7: 24,593,980	S17N	probably benign	Het
Foxi1	T	C	11: 34,207,578	D149G	probably damaging	Het
Fzd9	T	C	5: 135,249,621	E470G	probably damaging	Het
Ggnbp2	A	G	11: 84,862,246	F56L	probably damaging	Het
Gm5346	T	A	8: 43,627,079	Y36F	probably benign	Het
Hao1	G	A	2: 134,523,027	R227*	probably null	Het
Hyal1	G	A	9: 107,579,221	R369H	probably damaging	Het
Jam2	G	A	16: 84,812,952	V151M	probably damaging	Het
Kcna2	T	A	3: 107,105,417	I438N	probably benign	Het
Lrp1	A	T	10: 127,552,185	C3331*	probably null	Het
Mcm9	T	C	10: 53,548,527	I656V	probably benign	Het
Mroh9	C	T	1: 163,055,593	C439Y	probably damaging	Het
N4bp2l2	T	C	5: 150,650,695	D85G	probably damaging	Het
Nr1h2	A	G	7: 44,550,431	Y355H	probably damaging	Het
Nr5a2	T	C	1: 136,940,429	I322V	probably benign	Het
Nup153	A	C	13: 46,687,274	L273V	possibly damaging	Het
Obscn	A	G	11: 58,999,596	L7370P	unknown	Het
Olfr1270	T	A	2: 90,149,878	I43F	probably damaging	Het
Olfr178	A	G	16: 58,889,924	C99R	probably damaging	Het
Olfr403	T	C	11: 74,195,716	I71T	probably damaging	Het
Prkdc	G	A	16: 15,734,052	D2041N	probably damaging	Het
Ptdss1	A	G	13: 66,933,611	D35G	possibly damaging	Het
Ptprs	G	T	17: 56,417,666	T1118K	probably damaging	Het
Pygb	C	T	2: 150,815,116	T329I	probably benign	Het
Rhoh	T	A	5: 65,892,814	D142E	probably benign	Het
Saraf	C	A	8: 34,168,462	A306E	probably damaging	Het
Scn1a	T	C	2: 66,350,988	I64V	probably benign	Het
Sec16a	A	G	2: 26,430,570	W1333R	probably damaging	Het
Shroom1	A	T	11: 53,466,462	T651S	possibly damaging	Het
Skint3	C	A	4: 112,277,666	Y345*	probably null	Het
Slc1a7	T	A	4: 108,007,554	N263K	probably damaging	Het
Sptbn2	C	T	19: 4,739,239	R1236C	probably damaging	Het
Tbx21	T	C	11: 97,101,567	N226S	probably benign	Het
Tcrg-V1	T	A	13: 19,340,333	L76I	possibly damaging	Het
Thada	A	G	17: 84,435,650	L782P	probably damaging	Het
Tle1	T	G	4: 72,137,098	I446L	possibly damaging	Het
Triobp	A	G	15: 78,993,269	D1621G	probably damaging	Het
Unc80	A	T	1: 66,646,436	M2240L	probably benign	Het
Usp9x	A	G	X: 13,123,508	R776G	possibly damaging	Homo
Vangl1	T	C	3: 102,166,922	T290A	probably benign	Het
Vmn1r233	T	A	17: 20,994,131	I186F	probably benign	Het
Vmn2r102	G	A	17: 19,681,162	C517Y	probably damaging	Het
Vrk2	G	A	11: 26,471,611	T449M	possibly damaging	Het
Zfp518a	A	G	19: 40,911,860	S78G	probably benign	Het
Zscan25	T	C	5: 145,286,310	S131P	unknown	Het
Zscan29	G	A	2: 121,166,615	T140I	probably benign	Het

Other mutations in Trpm2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00730:Trpm2	APN	10	77942915	splice site	probably null
IGL00773:Trpm2	APN	10	77949214	nonsense	probably null
IGL00962:Trpm2	APN	10	77943916	splice site	probably benign
IGL01093:Trpm2	APN	10	77932280	missense	probably benign	0.04
IGL01124:Trpm2	APN	10	77945825	splice site	probably benign
IGL01301:Trpm2	APN	10	77923984	missense	probably damaging	1.00
IGL02094:Trpm2	APN	10	77942996	nonsense	probably null
IGL02175:Trpm2	APN	10	77937907	missense	probably benign	0.07
IGL02653:Trpm2	APN	10	77912669	missense	probably benign	0.19
IGL02667:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02668:Trpm2	APN	10	77935942	missense	probably damaging	1.00
IGL02828:Trpm2	APN	10	77918986	missense	probably benign	0.16
IGL02951:Trpm2	APN	10	77929278	missense	possibly damaging	0.95
IGL03188:Trpm2	APN	10	77918909	missense	probably benign	0.18
IGL03242:Trpm2	APN	10	77917734	missense	probably benign
IGL03405:Trpm2	APN	10	77966072	splice site	probably benign
Fugit	UTSW	10	77938368	missense	probably damaging	1.00
scusate	UTSW	10	77966994	nonsense	probably null
temporal	UTSW	10	77925682	missense	probably benign	0.30
ANU18:Trpm2	UTSW	10	77923984	missense	probably damaging	1.00
R0147:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0148:Trpm2	UTSW	10	77925825	missense	probably damaging	1.00
R0302:Trpm2	UTSW	10	77943990	splice site	probably benign
R0332:Trpm2	UTSW	10	77947988	missense	probably damaging	1.00
R0586:Trpm2	UTSW	10	77923516	missense	probably damaging	0.99
R0847:Trpm2	UTSW	10	77929288	missense	possibly damaging	0.94
R1183:Trpm2	UTSW	10	77923564	missense	probably damaging	1.00
R1472:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R1510:Trpm2	UTSW	10	77966994	nonsense	probably null
R1518:Trpm2	UTSW	10	77943005	missense	possibly damaging	0.67
R1564:Trpm2	UTSW	10	77942999	missense	probably benign	0.14
R1593:Trpm2	UTSW	10	77943076	missense	possibly damaging	0.71
R1617:Trpm2	UTSW	10	77935875	splice site	probably null
R1673:Trpm2	UTSW	10	77942944	missense	probably benign
R1912:Trpm2	UTSW	10	77945876	missense	probably benign	0.10
R1932:Trpm2	UTSW	10	77941158	missense	probably damaging	1.00
R1993:Trpm2	UTSW	10	77947989	missense	probably damaging	1.00
R2013:Trpm2	UTSW	10	77925766	missense	probably damaging	1.00
R2151:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R2201:Trpm2	UTSW	10	77920471	nonsense	probably null
R2217:Trpm2	UTSW	10	77941182	missense	probably damaging	1.00
R2312:Trpm2	UTSW	10	77918964	missense	probably benign	0.04
R2339:Trpm2	UTSW	10	77914806	splice site	probably benign
R2395:Trpm2	UTSW	10	77947880	missense	possibly damaging	0.69
R2396:Trpm2	UTSW	10	77930637	missense	probably benign	0.14
R2405:Trpm2	UTSW	10	77934724	missense	probably damaging	1.00
R2567:Trpm2	UTSW	10	77941174	missense	probably damaging	0.99
R3001:Trpm2	UTSW	10	77930534	critical splice donor site	probably null
R3002:Trpm2	UTSW	10	77930534	critical splice donor site	probably null
R3125:Trpm2	UTSW	10	77911374	missense	probably damaging	1.00
R3500:Trpm2	UTSW	10	77932302	missense	probably benign	0.03
R3777:Trpm2	UTSW	10	77935990	missense	probably benign	0.13
R3778:Trpm2	UTSW	10	77935990	missense	probably benign	0.13
R4272:Trpm2	UTSW	10	77933642	missense	probably damaging	1.00
R4384:Trpm2	UTSW	10	77917725	missense	probably benign	0.44
R4395:Trpm2	UTSW	10	77929219	missense	probably benign	0.01
R4423:Trpm2	UTSW	10	77935068	missense	probably benign	0.00
R4452:Trpm2	UTSW	10	77923593	missense	probably damaging	1.00
R4612:Trpm2	UTSW	10	77945916	missense	probably damaging	0.99
R4825:Trpm2	UTSW	10	77941173	missense	probably damaging	0.98
R4906:Trpm2	UTSW	10	77932189	nonsense	probably null
R4943:Trpm2	UTSW	10	77966007	missense	probably damaging	1.00
R4948:Trpm2	UTSW	10	77917792	missense	probably benign	0.34
R5046:Trpm2	UTSW	10	77966018	missense	probably damaging	1.00
R5320:Trpm2	UTSW	10	77923521	missense	probably benign	0.06
R5523:Trpm2	UTSW	10	77935961	missense	probably benign	0.04
R5562:Trpm2	UTSW	10	77959939	missense	possibly damaging	0.71
R5623:Trpm2	UTSW	10	77932139	missense	probably damaging	0.96
R5628:Trpm2	UTSW	10	77912636	missense	probably benign	0.00
R5633:Trpm2	UTSW	10	77938353	missense	possibly damaging	0.71
R5817:Trpm2	UTSW	10	77965980	missense	probably damaging	1.00
R5989:Trpm2	UTSW	10	77959900	missense	probably damaging	1.00
R6018:Trpm2	UTSW	10	77917713	missense	probably benign	0.00
R6075:Trpm2	UTSW	10	77935043	critical splice donor site	probably null
R6092:Trpm2	UTSW	10	77925682	missense	probably benign	0.30
R6309:Trpm2	UTSW	10	77938368	missense	probably damaging	1.00
R6327:Trpm2	UTSW	10	77932227	missense	probably damaging	1.00
R6568:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6579:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6640:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6642:Trpm2	UTSW	10	77937826	missense	probably benign	0.01
R6798:Trpm2	UTSW	10	77914740	missense	probably damaging	0.99
R6999:Trpm2	UTSW	10	77935891	missense	probably damaging	1.00
R7034:Trpm2	UTSW	10	77912592	missense	probably benign
R7036:Trpm2	UTSW	10	77912592	missense	probably benign
R7113:Trpm2	UTSW	10	77947931	missense	probably damaging	0.96
R7171:Trpm2	UTSW	10	77924014	missense	probably damaging	1.00
R7240:Trpm2	UTSW	10	77935876	critical splice donor site	probably null
R7274:Trpm2	UTSW	10	77923555	missense	probably benign	0.00
R7379:Trpm2	UTSW	10	77914734	missense	probably benign
R7527:Trpm2	UTSW	10	77966060	missense	probably benign	0.01
R7571:Trpm2	UTSW	10	77937950	missense	probably benign	0.21
R7600:Trpm2	UTSW	10	77938051	missense	probably benign	0.02
R7727:Trpm2	UTSW	10	77925789	missense	probably benign	0.34
R7771:Trpm2	UTSW	10	77932179	missense	probably benign	0.01
R7844:Trpm2	UTSW	10	77923506	missense	probably benign	0.00
R8158:Trpm2	UTSW	10	77947897	missense	probably damaging	0.99
R8225:Trpm2	UTSW	10	77947973	missense	probably damaging	1.00
R8226:Trpm2	UTSW	10	77947973	missense	probably damaging	1.00
R8239:Trpm2	UTSW	10	77936002	missense	probably benign	0.06
R8275:Trpm2	UTSW	10	77966025	nonsense	probably null
R8340:Trpm2	UTSW	10	77923624	nonsense	probably null
R8354:Trpm2	UTSW	10	77933649	missense	probably damaging	1.00
R8427:Trpm2	UTSW	10	77911402	missense	possibly damaging	0.93
R8445:Trpm2	UTSW	10	77910252	missense	probably damaging	1.00
R8769:Trpm2	UTSW	10	77932294	missense	probably benign	0.00
R9144:Trpm2	UTSW	10	77929288	missense	probably benign	0.01
R9286:Trpm2	UTSW	10	77941180	missense	probably benign	0.06
R9319:Trpm2	UTSW	10	77942942	nonsense	probably null
R9319:Trpm2	UTSW	10	77949198	missense	probably damaging	1.00
R9381:Trpm2	UTSW	10	77911357	missense	possibly damaging	0.90
Z1177:Trpm2	UTSW	10	77937868	missense	possibly damaging	0.94

Predicted Primers

PCR Primer
(F):5'- TAGGCTAAGCGCTGTTCTTC -3'
(R):5'- TCACCGATGAATGGCAGTG -3'

Sequencing Primer
(F):5'- TCGGCCAGCACCTTCTGTAG -3'
(R):5'- CCGATGAATGGCAGTGGAAGG -3'

Posted On

2015-10-08