Incidental Mutation 'R4662:Eml6'
ID352944
Institutional Source Beutler Lab
Gene Symbol Eml6
Ensembl Gene ENSMUSG00000044072
Gene Nameechinoderm microtubule associated protein like 6
Synonyms
MMRRC Submission 042011-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.248) question?
Stock #R4662 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location29743048-30026033 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 29777390 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 1244 (V1244E)
Ref Sequence ENSEMBL: ENSMUSP00000051080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058902]
Predicted Effect probably damaging
Transcript: ENSMUST00000058902
AA Change: V1244E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000051080
Gene: ENSMUSG00000044072
AA Change: V1244E

DomainStartEndE-ValueType
low complexity region 36 47 N/A INTRINSIC
WD40 49 91 1.79e-1 SMART
WD40 94 136 1.42e-4 SMART
WD40 139 178 5.31e-4 SMART
WD40 184 224 8.84e1 SMART
WD40 225 263 3.75e-4 SMART
WD40 313 353 4.69e-5 SMART
WD40 356 394 2.22e0 SMART
WD40 397 436 1.72e0 SMART
WD40 505 546 1.7e2 SMART
WD40 552 592 4.55e-3 SMART
low complexity region 613 625 N/A INTRINSIC
Pfam:HELP 653 715 1.9e-22 PFAM
WD40 716 757 9.24e-1 SMART
WD40 760 802 6.53e-4 SMART
WD40 805 844 2.98e-1 SMART
WD40 856 891 8.52e1 SMART
WD40 892 929 2.09e-2 SMART
WD40 986 1026 1.18e-1 SMART
WD40 1032 1068 3.44e0 SMART
WD40 1071 1111 2.58e-1 SMART
WD40 1180 1221 9.24e-1 SMART
WD40 1227 1267 3.85e-1 SMART
low complexity region 1280 1291 N/A INTRINSIC
Pfam:HELP 1329 1402 5e-15 PFAM
WD40 1404 1447 2.66e0 SMART
WD40 1450 1492 1.85e0 SMART
WD40 1495 1534 2.97e0 SMART
WD40 1543 1582 7.1e1 SMART
WD40 1584 1629 9.51e1 SMART
WD40 1675 1715 3.05e-4 SMART
WD40 1718 1758 8.84e1 SMART
WD40 1759 1798 7.16e-1 SMART
WD40 1869 1910 1.53e1 SMART
WD40 1916 1956 4.62e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A T 6: 91,914,958 Q67L probably benign Het
8030462N17Rik T A 18: 77,674,490 Q42L probably benign Het
Adrb1 A G 19: 56,722,774 T135A probably damaging Het
Asxl2 G T 12: 3,427,193 W13L probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Brsk1 T C 7: 4,707,299 S436P possibly damaging Het
Calb2 A G 8: 110,168,077 F21L probably benign Het
Camk2a T C 18: 60,941,339 Y39H probably damaging Het
Cavin2 T C 1: 51,301,351 S396P probably benign Het
Cfdp1 A G 8: 111,830,945 F188S probably benign Het
Chek2 T A 5: 110,867,042 V459D probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Cobl A G 11: 12,253,672 V1003A probably benign Het
Ctsll3 A G 13: 60,799,602 F257L possibly damaging Het
Dnajc13 A C 9: 104,207,758 F819V probably damaging Het
Dram1 C A 10: 88,325,384 V208L probably damaging Het
Dynlt1b A G 17: 6,431,880 T10A probably benign Het
Ethe1 G A 7: 24,593,980 S17N probably benign Het
Foxi1 T C 11: 34,207,578 D149G probably damaging Het
Fzd9 T C 5: 135,249,621 E470G probably damaging Het
Ggnbp2 A G 11: 84,862,246 F56L probably damaging Het
Gm5346 T A 8: 43,627,079 Y36F probably benign Het
Hao1 G A 2: 134,523,027 R227* probably null Het
Hyal1 G A 9: 107,579,221 R369H probably damaging Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Kcna2 T A 3: 107,105,417 I438N probably benign Het
Lrp1 A T 10: 127,552,185 C3331* probably null Het
Mcm9 T C 10: 53,548,527 I656V probably benign Het
Mroh9 C T 1: 163,055,593 C439Y probably damaging Het
N4bp2l2 T C 5: 150,650,695 D85G probably damaging Het
Nr1h2 A G 7: 44,550,431 Y355H probably damaging Het
Nr5a2 T C 1: 136,940,429 I322V probably benign Het
Nup153 A C 13: 46,687,274 L273V possibly damaging Het
Obscn A G 11: 58,999,596 L7370P unknown Het
Olfr1270 T A 2: 90,149,878 I43F probably damaging Het
Olfr178 A G 16: 58,889,924 C99R probably damaging Het
Olfr403 T C 11: 74,195,716 I71T probably damaging Het
Prkdc G A 16: 15,734,052 D2041N probably damaging Het
Ptdss1 A G 13: 66,933,611 D35G possibly damaging Het
Ptprs G T 17: 56,417,666 T1118K probably damaging Het
Pygb C T 2: 150,815,116 T329I probably benign Het
Rhoh T A 5: 65,892,814 D142E probably benign Het
Saraf C A 8: 34,168,462 A306E probably damaging Het
Scn1a T C 2: 66,350,988 I64V probably benign Het
Sec16a A G 2: 26,430,570 W1333R probably damaging Het
Shroom1 A T 11: 53,466,462 T651S possibly damaging Het
Skint3 C A 4: 112,277,666 Y345* probably null Het
Slc1a7 T A 4: 108,007,554 N263K probably damaging Het
Sptbn2 C T 19: 4,739,239 R1236C probably damaging Het
Tbx21 T C 11: 97,101,567 N226S probably benign Het
Tcrg-V1 T A 13: 19,340,333 L76I possibly damaging Het
Thada A G 17: 84,435,650 L782P probably damaging Het
Tle1 T G 4: 72,137,098 I446L possibly damaging Het
Triobp A G 15: 78,993,269 D1621G probably damaging Het
Trpm2 G C 10: 77,938,138 A481G probably benign Het
Unc80 A T 1: 66,646,436 M2240L probably benign Het
Usp9x A G X: 13,123,508 R776G possibly damaging Homo
Vangl1 T C 3: 102,166,922 T290A probably benign Het
Vmn1r233 T A 17: 20,994,131 I186F probably benign Het
Vmn2r102 G A 17: 19,681,162 C517Y probably damaging Het
Vrk2 G A 11: 26,471,611 T449M possibly damaging Het
Zfp518a A G 19: 40,911,860 S78G probably benign Het
Zscan25 T C 5: 145,286,310 S131P unknown Het
Zscan29 G A 2: 121,166,615 T140I probably benign Het
Other mutations in Eml6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Eml6 APN 11 29850816 critical splice donor site probably null
IGL01407:Eml6 APN 11 29755021 nonsense probably null
IGL01434:Eml6 APN 11 29819090 missense probably damaging 1.00
IGL01578:Eml6 APN 11 29850870 missense probably benign 0.02
IGL01780:Eml6 APN 11 29805175 missense probably benign 0.17
IGL01821:Eml6 APN 11 29821699 missense probably benign 0.00
IGL01837:Eml6 APN 11 29777055 missense probably benign 0.00
IGL01904:Eml6 APN 11 29838613 nonsense probably null
IGL01972:Eml6 APN 11 29838451 missense possibly damaging 0.67
IGL02134:Eml6 APN 11 29759066 missense probably benign 0.13
IGL02192:Eml6 APN 11 29805743 missense probably benign 0.00
IGL02377:Eml6 APN 11 29777282 missense probably damaging 0.98
IGL02584:Eml6 APN 11 29749387 missense probably damaging 0.99
IGL02587:Eml6 APN 11 29784236 missense possibly damaging 0.92
IGL02810:Eml6 APN 11 29849016 missense possibly damaging 0.94
IGL02873:Eml6 APN 11 29880700 missense probably benign 0.10
IGL02880:Eml6 APN 11 29749959 missense probably benign 0.03
IGL03289:Eml6 APN 11 29795328 missense possibly damaging 0.49
IGL03301:Eml6 APN 11 29764083 missense probably benign 0.18
IGL03386:Eml6 APN 11 29749934 missense probably benign
IGL03407:Eml6 APN 11 29906330 missense probably damaging 1.00
PIT4453001:Eml6 UTSW 11 29802489 missense probably damaging 1.00
R0125:Eml6 UTSW 11 29882088 missense probably benign 0.19
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0240:Eml6 UTSW 11 29792367 missense possibly damaging 0.84
R0271:Eml6 UTSW 11 29848949 missense possibly damaging 0.48
R0304:Eml6 UTSW 11 29777441 missense probably benign 0.00
R0415:Eml6 UTSW 11 29749392 missense possibly damaging 0.84
R0449:Eml6 UTSW 11 29893213 missense probably benign 0.01
R0538:Eml6 UTSW 11 29760010 splice site probably benign
R0671:Eml6 UTSW 11 29805065 missense probably benign 0.00
R0766:Eml6 UTSW 11 29831219 splice site probably benign
R0800:Eml6 UTSW 11 29749877 missense probably benign 0.08
R0841:Eml6 UTSW 11 29777430 missense probably benign 0.41
R0879:Eml6 UTSW 11 29850816 critical splice donor site probably null
R1061:Eml6 UTSW 11 29777267 missense probably damaging 1.00
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1145:Eml6 UTSW 11 29777430 missense probably benign 0.41
R1172:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1173:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1174:Eml6 UTSW 11 29749824 missense possibly damaging 0.54
R1199:Eml6 UTSW 11 29755044 missense possibly damaging 0.93
R1311:Eml6 UTSW 11 29831088 splice site probably benign
R1312:Eml6 UTSW 11 29831219 splice site probably benign
R1355:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1370:Eml6 UTSW 11 29833085 missense probably benign 0.03
R1457:Eml6 UTSW 11 30024459 missense probably damaging 1.00
R1486:Eml6 UTSW 11 29805114 missense possibly damaging 0.83
R1511:Eml6 UTSW 11 29818374 missense probably damaging 1.00
R1532:Eml6 UTSW 11 29792256 splice site probably null
R1642:Eml6 UTSW 11 29777001 critical splice donor site probably null
R1682:Eml6 UTSW 11 29759065 missense probably benign 0.13
R1687:Eml6 UTSW 11 29833187 missense probably damaging 1.00
R1699:Eml6 UTSW 11 29746282 nonsense probably null
R1796:Eml6 UTSW 11 29881975 missense probably benign 0.19
R1797:Eml6 UTSW 11 29882041 missense probably benign 0.09
R1837:Eml6 UTSW 11 29749802 splice site probably null
R1874:Eml6 UTSW 11 29831136 missense probably damaging 0.99
R1967:Eml6 UTSW 11 30024545 missense probably damaging 1.00
R1969:Eml6 UTSW 11 29833075 missense probably benign
R2007:Eml6 UTSW 11 29848814 critical splice donor site probably null
R2012:Eml6 UTSW 11 29831128 missense possibly damaging 0.85
R2198:Eml6 UTSW 11 29850935 missense probably benign 0.01
R2217:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2218:Eml6 UTSW 11 29818907 missense probably damaging 1.00
R2403:Eml6 UTSW 11 29802434 missense probably benign 0.05
R2520:Eml6 UTSW 11 29791993 missense probably damaging 1.00
R2937:Eml6 UTSW 11 29833049 splice site probably benign
R2938:Eml6 UTSW 11 29833049 splice site probably benign
R3085:Eml6 UTSW 11 29809332 missense probably damaging 0.96
R3236:Eml6 UTSW 11 29831097 critical splice donor site probably null
R3738:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3739:Eml6 UTSW 11 29803137 missense probably benign 0.20
R3752:Eml6 UTSW 11 29809360 missense probably benign 0.06
R3854:Eml6 UTSW 11 29749905 missense possibly damaging 0.76
R3941:Eml6 UTSW 11 29803167 missense probably damaging 0.98
R4034:Eml6 UTSW 11 29803137 missense probably benign 0.20
R4049:Eml6 UTSW 11 29838577 missense probably damaging 1.00
R4108:Eml6 UTSW 11 29805136 missense probably damaging 0.98
R4657:Eml6 UTSW 11 29805108 missense possibly damaging 0.77
R4665:Eml6 UTSW 11 29819007 nonsense probably null
R4721:Eml6 UTSW 11 29838525 missense possibly damaging 0.95
R4729:Eml6 UTSW 11 29833204 missense probably damaging 1.00
R4766:Eml6 UTSW 11 29805757 missense probably benign 0.22
R4810:Eml6 UTSW 11 29755011 missense possibly damaging 0.92
R4831:Eml6 UTSW 11 29777052 nonsense probably null
R5035:Eml6 UTSW 11 29854187 missense probably benign 0.00
R5064:Eml6 UTSW 11 29749300 missense probably benign 0.12
R5103:Eml6 UTSW 11 29850905 missense possibly damaging 0.65
R5121:Eml6 UTSW 11 29744606 missense probably benign 0.03
R5161:Eml6 UTSW 11 30024467 missense probably damaging 0.99
R5211:Eml6 UTSW 11 29854145 missense probably benign 0.02
R5268:Eml6 UTSW 11 29803108 missense probably benign 0.15
R5390:Eml6 UTSW 11 29760096 missense probably damaging 1.00
R5529:Eml6 UTSW 11 29764126 missense probably benign 0.04
R6239:Eml6 UTSW 11 29749275 missense probably damaging 1.00
R6326:Eml6 UTSW 11 29819066 missense probably damaging 1.00
R6395:Eml6 UTSW 11 29809321 missense probably benign 0.00
R6476:Eml6 UTSW 11 29791971 critical splice donor site probably null
R6483:Eml6 UTSW 11 29749875 missense probably benign 0.00
R6701:Eml6 UTSW 11 29785748 missense probably damaging 0.98
R6753:Eml6 UTSW 11 29754987 missense probably damaging 1.00
R6809:Eml6 UTSW 11 29803161 missense probably benign 0.23
R6847:Eml6 UTSW 11 29818447 missense probably benign 0.00
R6855:Eml6 UTSW 11 29751381 splice site probably null
R7168:Eml6 UTSW 11 29838529 missense probably benign 0.01
R7175:Eml6 UTSW 11 29784231 missense probably benign 0.00
R7305:Eml6 UTSW 11 29777258 missense probably benign 0.01
R7615:Eml6 UTSW 11 29802501 missense possibly damaging 0.49
R7692:Eml6 UTSW 11 29753085 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CAACACATGGCTGATTGGGG -3'
(R):5'- TGAGCCAGTCTTAAGGGGAGAC -3'

Sequencing Primer
(F):5'- GATTGGGGCTCACCTCCATC -3'
(R):5'- GGAGCATGTATTGTCATGATACAAGC -3'
Posted On2015-10-08