Incidental Mutation 'R4662:Olfr403'
ID352948
Institutional Source Beutler Lab
Gene Symbol Olfr403
Ensembl Gene ENSMUSG00000070378
Gene Nameolfactory receptor 403
SynonymsMOR125-5_p, IA7, GA_x6K02T2P1NL-4348188-4349129
MMRRC Submission 042011-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R4662 (G1)
Quality Score179
Status Not validated
Chromosome11
Chromosomal Location74186249-74198612 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74195716 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 71 (I71T)
Ref Sequence ENSEMBL: ENSMUSP00000145741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076675] [ENSMUST00000206114]
Predicted Effect probably damaging
Transcript: ENSMUST00000076675
AA Change: I71T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075971
Gene: ENSMUSG00000070378
AA Change: I71T

DomainStartEndE-ValueType
Pfam:7tm_4 31 306 7.3e-59 PFAM
Pfam:7tm_1 41 238 7.2e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000206114
AA Change: I71T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206247
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik A T 6: 91,914,958 Q67L probably benign Het
8030462N17Rik T A 18: 77,674,490 Q42L probably benign Het
Adrb1 A G 19: 56,722,774 T135A probably damaging Het
Asxl2 G T 12: 3,427,193 W13L probably damaging Het
Atp4a G A 7: 30,720,225 R671Q probably benign Het
Brsk1 T C 7: 4,707,299 S436P possibly damaging Het
Calb2 A G 8: 110,168,077 F21L probably benign Het
Camk2a T C 18: 60,941,339 Y39H probably damaging Het
Cavin2 T C 1: 51,301,351 S396P probably benign Het
Cfdp1 A G 8: 111,830,945 F188S probably benign Het
Chek2 T A 5: 110,867,042 V459D probably damaging Het
Cldn8 G A 16: 88,562,408 H210Y probably benign Het
Cobl A G 11: 12,253,672 V1003A probably benign Het
Ctsll3 A G 13: 60,799,602 F257L possibly damaging Het
Dnajc13 A C 9: 104,207,758 F819V probably damaging Het
Dram1 C A 10: 88,325,384 V208L probably damaging Het
Dynlt1b A G 17: 6,431,880 T10A probably benign Het
Eml6 A T 11: 29,777,390 V1244E probably damaging Het
Ethe1 G A 7: 24,593,980 S17N probably benign Het
Foxi1 T C 11: 34,207,578 D149G probably damaging Het
Fzd9 T C 5: 135,249,621 E470G probably damaging Het
Ggnbp2 A G 11: 84,862,246 F56L probably damaging Het
Gm5346 T A 8: 43,627,079 Y36F probably benign Het
Hao1 G A 2: 134,523,027 R227* probably null Het
Hyal1 G A 9: 107,579,221 R369H probably damaging Het
Jam2 G A 16: 84,812,952 V151M probably damaging Het
Kcna2 T A 3: 107,105,417 I438N probably benign Het
Lrp1 A T 10: 127,552,185 C3331* probably null Het
Mcm9 T C 10: 53,548,527 I656V probably benign Het
Mroh9 C T 1: 163,055,593 C439Y probably damaging Het
N4bp2l2 T C 5: 150,650,695 D85G probably damaging Het
Nr1h2 A G 7: 44,550,431 Y355H probably damaging Het
Nr5a2 T C 1: 136,940,429 I322V probably benign Het
Nup153 A C 13: 46,687,274 L273V possibly damaging Het
Obscn A G 11: 58,999,596 L7370P unknown Het
Olfr1270 T A 2: 90,149,878 I43F probably damaging Het
Olfr178 A G 16: 58,889,924 C99R probably damaging Het
Prkdc G A 16: 15,734,052 D2041N probably damaging Het
Ptdss1 A G 13: 66,933,611 D35G possibly damaging Het
Ptprs G T 17: 56,417,666 T1118K probably damaging Het
Pygb C T 2: 150,815,116 T329I probably benign Het
Rhoh T A 5: 65,892,814 D142E probably benign Het
Saraf C A 8: 34,168,462 A306E probably damaging Het
Scn1a T C 2: 66,350,988 I64V probably benign Het
Sec16a A G 2: 26,430,570 W1333R probably damaging Het
Shroom1 A T 11: 53,466,462 T651S possibly damaging Het
Skint3 C A 4: 112,277,666 Y345* probably null Het
Slc1a7 T A 4: 108,007,554 N263K probably damaging Het
Sptbn2 C T 19: 4,739,239 R1236C probably damaging Het
Tbx21 T C 11: 97,101,567 N226S probably benign Het
Tcrg-V1 T A 13: 19,340,333 L76I possibly damaging Het
Thada A G 17: 84,435,650 L782P probably damaging Het
Tle1 T G 4: 72,137,098 I446L possibly damaging Het
Triobp A G 15: 78,993,269 D1621G probably damaging Het
Trpm2 G C 10: 77,938,138 A481G probably benign Het
Unc80 A T 1: 66,646,436 M2240L probably benign Het
Usp9x A G X: 13,123,508 R776G possibly damaging Homo
Vangl1 T C 3: 102,166,922 T290A probably benign Het
Vmn1r233 T A 17: 20,994,131 I186F probably benign Het
Vmn2r102 G A 17: 19,681,162 C517Y probably damaging Het
Vrk2 G A 11: 26,471,611 T449M possibly damaging Het
Zfp518a A G 19: 40,911,860 S78G probably benign Het
Zscan25 T C 5: 145,286,310 S131P unknown Het
Zscan29 G A 2: 121,166,615 T140I probably benign Het
Other mutations in Olfr403
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Olfr403 APN 11 74195761 missense probably damaging 1.00
IGL01716:Olfr403 APN 11 74196381 missense probably benign 0.01
R0598:Olfr403 UTSW 11 74195832 missense possibly damaging 0.90
R1168:Olfr403 UTSW 11 74196421 missense probably benign
R1440:Olfr403 UTSW 11 74195679 missense probably damaging 1.00
R1657:Olfr403 UTSW 11 74195896 missense probably damaging 0.98
R1834:Olfr403 UTSW 11 74195653 missense probably benign 0.00
R1990:Olfr403 UTSW 11 74196163 missense probably damaging 0.99
R1991:Olfr403 UTSW 11 74196163 missense probably damaging 0.99
R2206:Olfr403 UTSW 11 74196324 missense possibly damaging 0.87
R2207:Olfr403 UTSW 11 74196324 missense possibly damaging 0.87
R3103:Olfr403 UTSW 11 74196075 missense probably benign 0.39
R4844:Olfr403 UTSW 11 74196076 missense probably damaging 0.98
R5336:Olfr403 UTSW 11 74196033 missense probably damaging 1.00
R5918:Olfr403 UTSW 11 74196118 missense probably damaging 0.96
R6858:Olfr403 UTSW 11 74196099 missense probably benign 0.01
R7175:Olfr403 UTSW 11 74196178 nonsense probably null
R7362:Olfr403 UTSW 11 74195586 missense probably benign 0.01
R7670:Olfr403 UTSW 11 74196207 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATTTCACTCTCCTGGGAGTTAC -3'
(R):5'- ACCAGCAGGACACAAAGTTG -3'

Sequencing Primer
(F):5'- TCTCCTGGGAGTTACAAGGCAG -3'
(R):5'- CATAATTGTTGCATAATGAAGCGGGC -3'
Posted On2015-10-08