Mutagenetix > Incidental Mutations

Incidental Mutation 'R4662:Ptprs'

352965

Institutional Source

Beutler Lab

Gene Symbol

Ptprs

Ensembl Gene

ENSMUSG00000013236

Gene Name

protein tyrosine phosphatase, receptor type, S

Synonyms

Ptpt9, PTP-NU3, RPTPsigma, PTPsigma

MMRRC Submission

042011-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4662 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

56412426-56476483 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 56417666 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 1118 (T1118K)

Ref Sequence

ENSEMBL: ENSMUSP00000084038 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067538] [ENSMUST00000086828] [ENSMUST00000223859]

Predicted Effect

probably damaging
Transcript: ENSMUST00000067538
AA Change: T1524K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000064048
Gene: ENSMUSG00000013236
AA Change: T1524K

Domain	Start	End	E-Value	Type
low complexity region	6	23	N/A	INTRINSIC
IGc2	45	114	3.38e-10	SMART
IGc2	147	214	2.4e-15	SMART
IGc2	244	305	8.26e-5	SMART
FN3	319	398	2.8e-14	SMART
FN3	414	497	3.24e-10	SMART
FN3	512	590	3.17e-13	SMART
FN3	605	692	9.69e-9	SMART
FN3	707	796	2.42e-9	SMART
FN3	811	890	2.22e0	SMART
FN3	905	995	8.31e-8	SMART
FN3	1009	1085	3.22e-5	SMART
low complexity region	1164	1177	N/A	INTRINSIC
transmembrane domain	1259	1281	N/A	INTRINSIC
PTPc	1351	1609	1.54e-136	SMART
PTPc	1638	1900	3.12e-128	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000086828
AA Change: T1118K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000084038
Gene: ENSMUSG00000013236
AA Change: T1118K

Domain	Start	End	E-Value	Type
low complexity region	6	23	N/A	INTRINSIC
IGc2	45	114	3.38e-10	SMART
IGc2	147	214	2.4e-15	SMART
IGc2	244	305	8.26e-5	SMART
FN3	319	398	2.8e-14	SMART
FN3	414	497	3.24e-10	SMART
FN3	512	590	3.17e-13	SMART
FN3	603	679	2.54e-3	SMART
low complexity region	758	771	N/A	INTRINSIC
transmembrane domain	853	875	N/A	INTRINSIC
PTPc	945	1203	1.54e-136	SMART
PTPc	1232	1494	3.12e-128	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143018

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000184960

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223685

Predicted Effect

probably damaging
Transcript: ENSMUST00000223859
AA Change: T1114K

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224522

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225379

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an extracellular region, a single transmembrane segment and two tandem intracytoplasmic catalytic domains, and thus represents a receptor-type PTP. The extracellular region of this protein is composed of multiple Ig-like and fibronectin type III-like domains. Studies of the similar gene in mice suggested that this PTP may be involved in cell-cell interaction, primary axonogenesis, and axon guidance during embryogenesis. This PTP has been also implicated in the molecular control of adult nerve repair. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Almost half of null homozygotes die in the first day of life. Embryos are characterized by decreased brain size including small pituitary glands and small olfactory bulbs. Adult mice are small, lack estrus, have decreased litter sizes and have impairedolfaction. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	A	T	6: 91,914,958	Q67L	probably benign	Het
8030462N17Rik	T	A	18: 77,674,490	Q42L	probably benign	Het
Adrb1	A	G	19: 56,722,774	T135A	probably damaging	Het
Asxl2	G	T	12: 3,427,193	W13L	probably damaging	Het
Atp4a	G	A	7: 30,720,225	R671Q	probably benign	Het
Brsk1	T	C	7: 4,707,299	S436P	possibly damaging	Het
Calb2	A	G	8: 110,168,077	F21L	probably benign	Het
Camk2a	T	C	18: 60,941,339	Y39H	probably damaging	Het
Cavin2	T	C	1: 51,301,351	S396P	probably benign	Het
Cfdp1	A	G	8: 111,830,945	F188S	probably benign	Het
Chek2	T	A	5: 110,867,042	V459D	probably damaging	Het
Cldn8	G	A	16: 88,562,408	H210Y	probably benign	Het
Cobl	A	G	11: 12,253,672	V1003A	probably benign	Het
Ctsll3	A	G	13: 60,799,602	F257L	possibly damaging	Het
Dnajc13	A	C	9: 104,207,758	F819V	probably damaging	Het
Dram1	C	A	10: 88,325,384	V208L	probably damaging	Het
Dynlt1b	A	G	17: 6,431,880	T10A	probably benign	Het
Eml6	A	T	11: 29,777,390	V1244E	probably damaging	Het
Ethe1	G	A	7: 24,593,980	S17N	probably benign	Het
Foxi1	T	C	11: 34,207,578	D149G	probably damaging	Het
Fzd9	T	C	5: 135,249,621	E470G	probably damaging	Het
Ggnbp2	A	G	11: 84,862,246	F56L	probably damaging	Het
Gm5346	T	A	8: 43,627,079	Y36F	probably benign	Het
Hao1	G	A	2: 134,523,027	R227*	probably null	Het
Hyal1	G	A	9: 107,579,221	R369H	probably damaging	Het
Jam2	G	A	16: 84,812,952	V151M	probably damaging	Het
Kcna2	T	A	3: 107,105,417	I438N	probably benign	Het
Lrp1	A	T	10: 127,552,185	C3331*	probably null	Het
Mcm9	T	C	10: 53,548,527	I656V	probably benign	Het
Mroh9	C	T	1: 163,055,593	C439Y	probably damaging	Het
N4bp2l2	T	C	5: 150,650,695	D85G	probably damaging	Het
Nr1h2	A	G	7: 44,550,431	Y355H	probably damaging	Het
Nr5a2	T	C	1: 136,940,429	I322V	probably benign	Het
Nup153	A	C	13: 46,687,274	L273V	possibly damaging	Het
Obscn	A	G	11: 58,999,596	L7370P	unknown	Het
Olfr1270	T	A	2: 90,149,878	I43F	probably damaging	Het
Olfr178	A	G	16: 58,889,924	C99R	probably damaging	Het
Olfr403	T	C	11: 74,195,716	I71T	probably damaging	Het
Prkdc	G	A	16: 15,734,052	D2041N	probably damaging	Het
Ptdss1	A	G	13: 66,933,611	D35G	possibly damaging	Het
Pygb	C	T	2: 150,815,116	T329I	probably benign	Het
Rhoh	T	A	5: 65,892,814	D142E	probably benign	Het
Saraf	C	A	8: 34,168,462	A306E	probably damaging	Het
Scn1a	T	C	2: 66,350,988	I64V	probably benign	Het
Sec16a	A	G	2: 26,430,570	W1333R	probably damaging	Het
Shroom1	A	T	11: 53,466,462	T651S	possibly damaging	Het
Skint3	C	A	4: 112,277,666	Y345*	probably null	Het
Slc1a7	T	A	4: 108,007,554	N263K	probably damaging	Het
Sptbn2	C	T	19: 4,739,239	R1236C	probably damaging	Het
Tbx21	T	C	11: 97,101,567	N226S	probably benign	Het
Tcrg-V1	T	A	13: 19,340,333	L76I	possibly damaging	Het
Thada	A	G	17: 84,435,650	L782P	probably damaging	Het
Tle1	T	G	4: 72,137,098	I446L	possibly damaging	Het
Triobp	A	G	15: 78,993,269	D1621G	probably damaging	Het
Trpm2	G	C	10: 77,938,138	A481G	probably benign	Het
Unc80	A	T	1: 66,646,436	M2240L	probably benign	Het
Usp9x	A	G	X: 13,123,508	R776G	possibly damaging	Homo
Vangl1	T	C	3: 102,166,922	T290A	probably benign	Het
Vmn1r233	T	A	17: 20,994,131	I186F	probably benign	Het
Vmn2r102	G	A	17: 19,681,162	C517Y	probably damaging	Het
Vrk2	G	A	11: 26,471,611	T449M	possibly damaging	Het
Zfp518a	A	G	19: 40,911,860	S78G	probably benign	Het
Zscan25	T	C	5: 145,286,310	S131P	unknown	Het
Zscan29	G	A	2: 121,166,615	T140I	probably benign	Het

Other mutations in Ptprs

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00979:Ptprs	APN	17	56458243	missense	probably damaging	0.99
IGL01388:Ptprs	APN	17	56421261	missense	probably damaging	1.00
IGL01568:Ptprs	APN	17	56413958	missense	probably damaging	1.00
IGL01781:Ptprs	APN	17	56435676	missense	probably damaging	1.00
IGL02499:Ptprs	APN	17	56437884	missense	probably damaging	1.00
IGL02576:Ptprs	APN	17	56414958	missense	probably damaging	1.00
IGL02736:Ptprs	APN	17	56458248	missense	possibly damaging	0.88
IGL02871:Ptprs	APN	17	56447443	missense	probably damaging	1.00
IGL02946:Ptprs	APN	17	56424032	missense	probably benign
IGL03061:Ptprs	APN	17	56418830	missense	probably damaging	0.96
IGL03347:Ptprs	APN	17	56435972	missense	probably benign	0.07
IGL03351:Ptprs	APN	17	56437943	missense	probably damaging	1.00
P0019:Ptprs	UTSW	17	56447474	splice site	probably benign
PIT4434001:Ptprs	UTSW	17	56454984	missense	probably null	0.02
PIT4520001:Ptprs	UTSW	17	56414980	missense	probably damaging	1.00
R0240:Ptprs	UTSW	17	56436087	splice site	probably null
R0240:Ptprs	UTSW	17	56436087	splice site	probably null
R0504:Ptprs	UTSW	17	56454220	missense	possibly damaging	0.60
R0518:Ptprs	UTSW	17	56419621	critical splice donor site	probably null
R0539:Ptprs	UTSW	17	56458255	missense	probably damaging	0.97
R0620:Ptprs	UTSW	17	56429103	missense	possibly damaging	0.93
R0683:Ptprs	UTSW	17	56414086	missense	probably damaging	1.00
R1147:Ptprs	UTSW	17	56423504	missense	probably damaging	1.00
R1147:Ptprs	UTSW	17	56423504	missense	probably damaging	1.00
R1474:Ptprs	UTSW	17	56424128	missense	probably damaging	0.98
R1502:Ptprs	UTSW	17	56437992	missense	probably benign	0.00
R1817:Ptprs	UTSW	17	56419527	missense	probably damaging	1.00
R1844:Ptprs	UTSW	17	56434510	missense	probably damaging	1.00
R2077:Ptprs	UTSW	17	56434990	missense	probably null	0.26
R2086:Ptprs	UTSW	17	56454984	missense	probably null	0.02
R2149:Ptprs	UTSW	17	56417706	missense	probably damaging	1.00
R3618:Ptprs	UTSW	17	56428965	missense	probably benign	0.25
R3722:Ptprs	UTSW	17	56417485	missense	probably damaging	1.00
R3771:Ptprs	UTSW	17	56428978	missense	possibly damaging	0.58
R3772:Ptprs	UTSW	17	56428978	missense	possibly damaging	0.58
R3773:Ptprs	UTSW	17	56428978	missense	possibly damaging	0.58
R4032:Ptprs	UTSW	17	56413386	missense	probably damaging	1.00
R4326:Ptprs	UTSW	17	56447468	missense	possibly damaging	0.83
R4327:Ptprs	UTSW	17	56447468	missense	possibly damaging	0.83
R4480:Ptprs	UTSW	17	56426404	missense	possibly damaging	0.79
R4505:Ptprs	UTSW	17	56451678	missense	possibly damaging	0.57
R4507:Ptprs	UTSW	17	56419014	missense	probably damaging	1.00
R4588:Ptprs	UTSW	17	56425534	missense	probably damaging	1.00
R4708:Ptprs	UTSW	17	56428067	missense	probably damaging	1.00
R5016:Ptprs	UTSW	17	56419070	missense	probably damaging	1.00
R5416:Ptprs	UTSW	17	56435724	missense	probably damaging	1.00
R5447:Ptprs	UTSW	17	56429128	missense	possibly damaging	0.50
R6041:Ptprs	UTSW	17	56419080	missense	probably benign	0.00
R6329:Ptprs	UTSW	17	56417427	nonsense	probably null
R6377:Ptprs	UTSW	17	56418935	missense	probably damaging	1.00
R6605:Ptprs	UTSW	17	56422195	missense	probably damaging	1.00
R6749:Ptprs	UTSW	17	56437884	missense	probably damaging	1.00
R7113:Ptprs	UTSW	17	56451697	missense	probably benign	0.40
R7114:Ptprs	UTSW	17	56451697	missense	probably benign	0.40
R7133:Ptprs	UTSW	17	56417429	missense	probably damaging	1.00
R7220:Ptprs	UTSW	17	56418988	missense	probably benign	0.29
R7423:Ptprs	UTSW	17	56414793	missense	probably damaging	1.00
R7440:Ptprs	UTSW	17	56424256	missense	possibly damaging	0.75
R7457:Ptprs	UTSW	17	56419502	missense	probably damaging	0.99
R7574:Ptprs	UTSW	17	56423538	missense	probably benign	0.00
R7851:Ptprs	UTSW	17	56425482	missense	probably benign
R7903:Ptprs	UTSW	17	56424960	nonsense	probably null
R8013:Ptprs	UTSW	17	56435994	missense	probably damaging	1.00
R8014:Ptprs	UTSW	17	56435994	missense	probably damaging	1.00
R8094:Ptprs	UTSW	17	56428947	missense	probably benign	0.01
R8112:Ptprs	UTSW	17	56434532	nonsense	probably null
R8181:Ptprs	UTSW	17	56429064	missense	probably damaging	1.00
R8511:Ptprs	UTSW	17	56447440	missense	probably damaging	1.00
R8682:Ptprs	UTSW	17	56435849	missense	probably damaging	0.98
RF014:Ptprs	UTSW	17	56416935	missense	probably damaging	1.00
X0028:Ptprs	UTSW	17	56437831	missense	probably damaging	1.00
Z1176:Ptprs	UTSW	17	56417050	missense	possibly damaging	0.82
Z1176:Ptprs	UTSW	17	56422211	nonsense	probably null
Z1176:Ptprs	UTSW	17	56434468	missense	possibly damaging	0.66

Predicted Primers

PCR Primer
(F):5'- TTACGATGAAGCAGCCAGTG -3'
(R):5'- CAGGACTTCGGTTGATGAGATG -3'

Sequencing Primer
(F):5'- CAAACACCATGGTCAGG -3'
(R):5'- ACTTCGGTTGATGAGATGGGGAAC -3'

Posted On

2015-10-08