Mutagenetix > Incidental Mutations

Incidental Mutation 'R4663:Aqr'

352985

Institutional Source

Beutler Lab

Gene Symbol

Aqr

Ensembl Gene

ENSMUSG00000040383

Gene Name

aquarius

Synonyms

MMRRC Submission

041921-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4663 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

114101170-114187024 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 114161666 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 76 (Y76*)

Ref Sequence

ENSEMBL: ENSMUSP00000099602 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043160] [ENSMUST00000102543]

Predicted Effect

probably null
Transcript: ENSMUST00000043160
AA Change: Y76*

SMART Domains

Protein: ENSMUSP00000047157
Gene: ENSMUSG00000040383
AA Change: Y76*

Domain	Start	End	E-Value	Type
Pfam:Aquarius_N	18	802	N/A	PFAM
Pfam:ResIII	797	911	8.2e-7	PFAM
Pfam:AAA_11	801	1111	9.6e-32	PFAM
Pfam:AAA_19	807	894	3.7e-11	PFAM
Pfam:AAA_12	1119	1312	2.1e-27	PFAM
low complexity region	1394	1417	N/A	INTRINSIC
low complexity region	1455	1468	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000102543
AA Change: Y76*

SMART Domains

Protein: ENSMUSP00000099602
Gene: ENSMUSG00000040383
AA Change: Y76*

Domain	Start	End	E-Value	Type
low complexity region	43	56	N/A	INTRINSIC
low complexity region	112	124	N/A	INTRINSIC
low complexity region	762	776	N/A	INTRINSIC
Pfam:AAA_11	801	1111	3.2e-32	PFAM
Pfam:AAA_19	807	893	6.5e-11	PFAM
Pfam:AAA_12	1119	1312	2.6e-27	PFAM
low complexity region	1348	1359	N/A	INTRINSIC
low complexity region	1371	1382	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125460

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129504

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000131785

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe defects in placental vascularization with few vessels entering the placenta and little branching. Mutants die between embryonic days 9.5 and 10.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,218,455	V1496A	probably benign	Het
Armc5	C	A	7: 128,238,545	A140E	probably benign	Het
Auts2	T	C	5: 131,439,638	H947R	probably damaging	Het
Bag2	T	C	1: 33,746,993	T83A	probably damaging	Het
Bag4	C	T	8: 25,769,488	A228T	probably benign	Het
Bean1	A	G	8: 104,211,167	Y126C	probably damaging	Het
Cars	T	C	7: 143,575,960	E330G	probably damaging	Het
Ccdc40	A	G	11: 119,231,506	I45V	probably benign	Het
Cd320	G	A	17: 33,848,178	G214R	probably null	Het
Ckm	G	A	7: 19,419,494	V237M	probably damaging	Het
Cspg4	T	C	9: 56,886,676	V565A	possibly damaging	Het
Ephb6	A	G	6: 41,617,865	Y638C	probably damaging	Het
Epp13	T	G	7: 6,258,625	I35S	possibly damaging	Het
Fam196a	A	T	7: 134,899,148	Y409*	probably null	Het
Fat2	G	C	11: 55,296,213	S1269*	probably null	Het
Fbxo3	T	C	2: 104,053,475	V348A	probably damaging	Het
Gas6	G	A	8: 13,470,254	P478L	probably damaging	Het
Gm11492	T	A	11: 87,567,603	Y268N	probably damaging	Het
Herc1	T	C	9: 66,433,378	S1670P	probably damaging	Het
Hnrnpk	C	A	13: 58,394,517	R281L	probably damaging	Het
Ifih1	C	A	2: 62,609,219	C488F	probably benign	Het
Ift172	T	C	5: 31,284,215	K192E	probably benign	Het
Ighv5-9	T	A	12: 113,661,820	Q101L	probably benign	Het
Igkv3-2	G	T	6: 70,698,879	M57I	probably benign	Het
Itpr2	A	G	6: 146,373,173	F837S	probably damaging	Het
L3mbtl3	T	C	10: 26,337,817	Y237C	unknown	Het
Lats1	G	A	10: 7,712,583	C988Y	probably damaging	Het
Lgals3	T	A	14: 47,381,622		probably null	Het
Lrrc3b	G	T	14: 15,358,220	H129N	probably benign	Het
Lrriq1	T	C	10: 103,063,412	H1656R	possibly damaging	Het
Lypd6	T	G	2: 50,173,611	Y43*	probably null	Het
Mfsd7a	T	C	5: 108,442,145	M464V	probably benign	Het
Mical2	A	G	7: 112,328,677	D674G	possibly damaging	Het
Msi1	G	A	5: 115,450,275	R284Q	probably damaging	Het
Mybpc2	T	C	7: 44,505,642	E947G	probably damaging	Het
Nat14	T	A	7: 4,924,447	L206Q	probably damaging	Het
Nup88	A	T	11: 70,965,846		probably null	Het
Olfr27	A	T	9: 39,144,849	I250F	probably damaging	Het
Olfr727	A	G	14: 50,127,482	R302G	probably benign	Het
Olfr743	A	T	14: 50,533,604	Y64F	probably damaging	Het
Pdcl	T	C	2: 37,355,766	E75G	probably damaging	Het
Phf14	A	G	6: 11,953,422	I387V	possibly damaging	Het
Phf3	G	A	1: 30,821,215	R845W	probably damaging	Het
Pm20d1	T	C	1: 131,798,602	I59T	probably damaging	Het
Prkd1	C	T	12: 50,419,848		probably null	Het
Psmb2	T	C	4: 126,677,765	L4P	probably damaging	Het
Pttg1	T	A	11: 43,424,850	K46*	probably null	Het
Rrnad1	A	G	3: 87,927,748	S82P	probably damaging	Het
Ryr2	T	C	13: 11,749,509	H1401R	possibly damaging	Het
Sh3d19	G	A	3: 86,123,263	D696N	probably benign	Het
Slc16a2	T	C	X: 103,707,979	T274A	probably benign	Het
Slc26a6	G	A	9: 108,857,907	A335T	probably damaging	Het
Slc6a5	C	A	7: 49,938,398	Y493*	probably null	Het
Slf1	A	T	13: 77,126,604	S37R	probably damaging	Het
Smoc1	G	A	12: 81,167,602	G264S	probably damaging	Het
Snapc4	T	C	2: 26,374,181	E280G	possibly damaging	Het
Snx25	G	A	8: 46,035,579	T913M	probably damaging	Het
Snx7	T	C	3: 117,800,879	T408A	probably benign	Het
Spdya	T	A	17: 71,578,344	S264R	probably benign	Het
Spg11	A	T	2: 122,098,099		probably null	Het
Suz12	T	A	11: 80,013,524	L230Q	probably damaging	Het
Szt2	A	G	4: 118,377,684		probably benign	Het
Tenm3	C	A	8: 48,235,970	R2194L	probably damaging	Het
Tmed8	T	A	12: 87,174,231	I194F	probably damaging	Het
Tmem79	T	A	3: 88,333,444	T66S	probably damaging	Het
Trappc1	T	A	11: 69,325,511	S118T	probably benign	Het
Ttn	C	T	2: 76,738,881	V27223I	probably benign	Het
Ttn	T	C	2: 76,776,495	T18024A	probably damaging	Het
Vmn2r15	C	T	5: 109,294,074	M164I	probably benign	Het
Vmn2r53	T	A	7: 12,600,974	Y253F	probably benign	Het
Wdr92	T	C	11: 17,232,853	V338A	probably benign	Het
Zfand6	C	T	7: 84,617,885	R163H	probably benign	Het

Other mutations in Aqr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00572:Aqr	APN	2	114125942	missense	possibly damaging	0.90
IGL00694:Aqr	APN	2	114151525	missense	probably damaging	1.00
IGL02113:Aqr	APN	2	114120027	nonsense	probably null
IGL02297:Aqr	APN	2	114150481	missense	probably benign	0.24
IGL02380:Aqr	APN	2	114109936	missense	probably damaging	1.00
IGL02410:Aqr	APN	2	114136917	missense	possibly damaging	0.85
IGL02413:Aqr	APN	2	114118780	missense	possibly damaging	0.87
IGL02474:Aqr	APN	2	114112646	missense	probably damaging	1.00
IGL02941:Aqr	APN	2	114113354	missense	probably damaging	1.00
IGL02981:Aqr	APN	2	114134824	splice site	probably benign
IGL03001:Aqr	APN	2	114146919	missense	probably benign
IGL03092:Aqr	APN	2	114158943	missense	probably benign	0.38
IGL03222:Aqr	APN	2	114121256	missense	probably damaging	1.00
capricorn	UTSW	2	114105882	missense	probably damaging	1.00
Goat	UTSW	2	114157575	missense	probably damaging	1.00
Pliades	UTSW	2	114132976	missense	probably damaging	1.00
sagittarius	UTSW	2	114149016	missense	probably damaging	1.00
Zodiac	UTSW	2	114108109	missense	probably damaging	0.96
PIT4531001:Aqr	UTSW	2	114130734	missense	possibly damaging	0.94
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0103:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R0152:Aqr	UTSW	2	114159010	missense	probably benign	0.07
R0352:Aqr	UTSW	2	114170052	missense	probably damaging	1.00
R0371:Aqr	UTSW	2	114157604	missense	possibly damaging	0.80
R0374:Aqr	UTSW	2	114130611	missense	probably damaging	1.00
R0550:Aqr	UTSW	2	114132976	missense	probably damaging	1.00
R0604:Aqr	UTSW	2	114130604	missense	probably benign	0.00
R0685:Aqr	UTSW	2	114140977	missense	probably damaging	1.00
R1236:Aqr	UTSW	2	114116655	missense	probably damaging	1.00
R1434:Aqr	UTSW	2	114150409	missense	probably damaging	1.00
R1806:Aqr	UTSW	2	114161652	missense	probably damaging	1.00
R2154:Aqr	UTSW	2	114137004	missense	probably damaging	1.00
R2185:Aqr	UTSW	2	114130534	critical splice donor site	probably null
R2377:Aqr	UTSW	2	114140940	missense	possibly damaging	0.58
R2862:Aqr	UTSW	2	114136917	missense	probably damaging	1.00
R3615:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3616:Aqr	UTSW	2	114136887	missense	probably damaging	1.00
R3713:Aqr	UTSW	2	114118669	splice site	probably benign
R3715:Aqr	UTSW	2	114118669	splice site	probably benign
R4586:Aqr	UTSW	2	114112577	missense	probably benign	0.06
R4809:Aqr	UTSW	2	114175214	utr 5 prime	probably benign
R4887:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4888:Aqr	UTSW	2	114150509	missense	probably damaging	1.00
R4952:Aqr	UTSW	2	114109937	missense	probably damaging	1.00
R4974:Aqr	UTSW	2	114113351	missense	probably damaging	1.00
R5050:Aqr	UTSW	2	114112609	nonsense	probably null
R5050:Aqr	UTSW	2	114170025	critical splice donor site	probably null
R5213:Aqr	UTSW	2	114113327	missense	probably damaging	1.00
R5263:Aqr	UTSW	2	114116578	missense	probably damaging	1.00
R5470:Aqr	UTSW	2	114157575	missense	probably damaging	1.00
R5488:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5489:Aqr	UTSW	2	114133073	missense	probably damaging	1.00
R5567:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5570:Aqr	UTSW	2	114148970	missense	probably damaging	1.00
R5641:Aqr	UTSW	2	114149034	missense	probably damaging	1.00
R5685:Aqr	UTSW	2	114156265	missense	possibly damaging	0.87
R5963:Aqr	UTSW	2	114126961	missense	probably damaging	1.00
R5992:Aqr	UTSW	2	114143049	nonsense	probably null
R6015:Aqr	UTSW	2	114175165	start codon destroyed	probably null	0.53
R6253:Aqr	UTSW	2	114156277	missense	possibly damaging	0.93
R6264:Aqr	UTSW	2	114109964	missense	probably damaging	1.00
R6773:Aqr	UTSW	2	114148996	missense	possibly damaging	0.64
R6877:Aqr	UTSW	2	114116571	nonsense	probably null
R7211:Aqr	UTSW	2	114134723	missense	probably benign	0.01
R7232:Aqr	UTSW	2	114105882	missense	probably damaging	1.00
R7308:Aqr	UTSW	2	114104062	missense	possibly damaging	0.86
R7396:Aqr	UTSW	2	114119946	nonsense	probably null
R7490:Aqr	UTSW	2	114158868	critical splice donor site	probably null
R7526:Aqr	UTSW	2	114108109	missense	probably damaging	0.96
R7629:Aqr	UTSW	2	114114593	missense	probably damaging	1.00
R7828:Aqr	UTSW	2	114149016	missense	probably damaging	1.00
R8037:Aqr	UTSW	2	114161680	missense	probably damaging	1.00
R8166:Aqr	UTSW	2	114113325	missense	possibly damaging	0.95
R8712:Aqr	UTSW	2	114118877	missense	probably damaging	1.00
R8904:Aqr	UTSW	2	114136993	missense	probably damaging	0.98
Z1176:Aqr	UTSW	2	114108122	missense	probably damaging	0.98
Z1176:Aqr	UTSW	2	114109991	missense	probably benign	0.25

Predicted Primers

PCR Primer
(F):5'- TTGGCAGTAAGAGGACACTGC -3'
(R):5'- TTCTACATCTACGTGTCCGGTG -3'

Sequencing Primer
(F):5'- CAGTAAGAGGACACTGCTACCAG -3'
(R):5'- TACGTGTCCGGTGGCAGC -3'

Posted On

2015-10-08