Incidental Mutation 'R4663:Rrnad1'
ID 352988
Institutional Source Beutler Lab
Gene Symbol Rrnad1
Ensembl Gene ENSMUSG00000004896
Gene Name ribosomal RNA adenine dimethylase domain containing 1
Synonyms BC023814
MMRRC Submission 041921-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock # R4663 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 87922601-87930717 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 87927748 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 82 (S82P)
Ref Sequence ENSEMBL: ENSMUSP00000005016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005016] [ENSMUST00000019854] [ENSMUST00000055984] [ENSMUST00000119968] [ENSMUST00000121048] [ENSMUST00000121920] [ENSMUST00000160074] [ENSMUST00000160143] [ENSMUST00000160648] [ENSMUST00000164439]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000005016
AA Change: S82P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000005016
Gene: ENSMUSG00000004896
AA Change: S82P

DomainStartEndE-ValueType
Pfam:Methyltransf_32 133 293 1.5e-29 PFAM
low complexity region 385 402 N/A INTRINSIC
low complexity region 412 426 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000019854
SMART Domains Protein: ENSMUSP00000019854
Gene: ENSMUSG00000019710

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
KOW 55 82 7.17e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000055984
SMART Domains Protein: ENSMUSP00000059783
Gene: ENSMUSG00000048039

DomainStartEndE-ValueType
low complexity region 128 145 N/A INTRINSIC
low complexity region 157 168 N/A INTRINSIC
EXOIII 193 359 3.34e-38 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119968
SMART Domains Protein: ENSMUSP00000114111
Gene: ENSMUSG00000019710

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
KOW 55 82 7.17e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121048
SMART Domains Protein: ENSMUSP00000113959
Gene: ENSMUSG00000019710

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
KOW 55 82 7.17e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000121920
SMART Domains Protein: ENSMUSP00000112885
Gene: ENSMUSG00000019710

DomainStartEndE-ValueType
low complexity region 3 16 N/A INTRINSIC
KOW 55 82 7.17e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159091
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159967
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160068
Predicted Effect probably benign
Transcript: ENSMUST00000160074
SMART Domains Protein: ENSMUSP00000125365
Gene: ENSMUSG00000004896

DomainStartEndE-ValueType
Pfam:Methyltransf_32 69 229 1.3e-29 PFAM
low complexity region 321 338 N/A INTRINSIC
low complexity region 348 362 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160143
AA Change: S82P

PolyPhen 2 Score 0.678 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000124113
Gene: ENSMUSG00000004896
AA Change: S82P

DomainStartEndE-ValueType
Pfam:Methyltransf_32 133 247 5e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160648
Predicted Effect possibly damaging
Transcript: ENSMUST00000164439
AA Change: V31A

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161014
Predicted Effect noncoding transcript
Transcript: ENSMUST00000168070
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161471
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,218,455 V1496A probably benign Het
Aqr A T 2: 114,161,666 Y76* probably null Het
Armc5 C A 7: 128,238,545 A140E probably benign Het
Auts2 T C 5: 131,439,638 H947R probably damaging Het
Bag2 T C 1: 33,746,993 T83A probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bean1 A G 8: 104,211,167 Y126C probably damaging Het
Cars T C 7: 143,575,960 E330G probably damaging Het
Ccdc40 A G 11: 119,231,506 I45V probably benign Het
Cd320 G A 17: 33,848,178 G214R probably null Het
Ckm G A 7: 19,419,494 V237M probably damaging Het
Cspg4 T C 9: 56,886,676 V565A possibly damaging Het
Ephb6 A G 6: 41,617,865 Y638C probably damaging Het
Epp13 T G 7: 6,258,625 I35S possibly damaging Het
Fam196a A T 7: 134,899,148 Y409* probably null Het
Fat2 G C 11: 55,296,213 S1269* probably null Het
Fbxo3 T C 2: 104,053,475 V348A probably damaging Het
Gas6 G A 8: 13,470,254 P478L probably damaging Het
Gm11492 T A 11: 87,567,603 Y268N probably damaging Het
Herc1 T C 9: 66,433,378 S1670P probably damaging Het
Hnrnpk C A 13: 58,394,517 R281L probably damaging Het
Ifih1 C A 2: 62,609,219 C488F probably benign Het
Ift172 T C 5: 31,284,215 K192E probably benign Het
Ighv5-9 T A 12: 113,661,820 Q101L probably benign Het
Igkv3-2 G T 6: 70,698,879 M57I probably benign Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
L3mbtl3 T C 10: 26,337,817 Y237C unknown Het
Lats1 G A 10: 7,712,583 C988Y probably damaging Het
Lgals3 T A 14: 47,381,622 probably null Het
Lrrc3b G T 14: 15,358,220 H129N probably benign Het
Lrriq1 T C 10: 103,063,412 H1656R possibly damaging Het
Lypd6 T G 2: 50,173,611 Y43* probably null Het
Mfsd7a T C 5: 108,442,145 M464V probably benign Het
Mical2 A G 7: 112,328,677 D674G possibly damaging Het
Msi1 G A 5: 115,450,275 R284Q probably damaging Het
Mybpc2 T C 7: 44,505,642 E947G probably damaging Het
Nat14 T A 7: 4,924,447 L206Q probably damaging Het
Nup88 A T 11: 70,965,846 probably null Het
Olfr27 A T 9: 39,144,849 I250F probably damaging Het
Olfr727 A G 14: 50,127,482 R302G probably benign Het
Olfr743 A T 14: 50,533,604 Y64F probably damaging Het
Pdcl T C 2: 37,355,766 E75G probably damaging Het
Phf14 A G 6: 11,953,422 I387V possibly damaging Het
Phf3 G A 1: 30,821,215 R845W probably damaging Het
Pm20d1 T C 1: 131,798,602 I59T probably damaging Het
Prkd1 C T 12: 50,419,848 probably null Het
Psmb2 T C 4: 126,677,765 L4P probably damaging Het
Pttg1 T A 11: 43,424,850 K46* probably null Het
Ryr2 T C 13: 11,749,509 H1401R possibly damaging Het
Sh3d19 G A 3: 86,123,263 D696N probably benign Het
Slc16a2 T C X: 103,707,979 T274A probably benign Het
Slc26a6 G A 9: 108,857,907 A335T probably damaging Het
Slc6a5 C A 7: 49,938,398 Y493* probably null Het
Slf1 A T 13: 77,126,604 S37R probably damaging Het
Smoc1 G A 12: 81,167,602 G264S probably damaging Het
Snapc4 T C 2: 26,374,181 E280G possibly damaging Het
Snx25 G A 8: 46,035,579 T913M probably damaging Het
Snx7 T C 3: 117,800,879 T408A probably benign Het
Spdya T A 17: 71,578,344 S264R probably benign Het
Spg11 A T 2: 122,098,099 probably null Het
Suz12 T A 11: 80,013,524 L230Q probably damaging Het
Szt2 A G 4: 118,377,684 probably benign Het
Tenm3 C A 8: 48,235,970 R2194L probably damaging Het
Tmed8 T A 12: 87,174,231 I194F probably damaging Het
Tmem79 T A 3: 88,333,444 T66S probably damaging Het
Trappc1 T A 11: 69,325,511 S118T probably benign Het
Ttn C T 2: 76,738,881 V27223I probably benign Het
Ttn T C 2: 76,776,495 T18024A probably damaging Het
Vmn2r15 C T 5: 109,294,074 M164I probably benign Het
Vmn2r53 T A 7: 12,600,974 Y253F probably benign Het
Wdr92 T C 11: 17,232,853 V338A probably benign Het
Zfand6 C T 7: 84,617,885 R163H probably benign Het
Other mutations in Rrnad1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1775:Rrnad1 UTSW 3 87923817 missense probably damaging 0.99
R2165:Rrnad1 UTSW 3 87927053 critical splice donor site probably null
R2307:Rrnad1 UTSW 3 87926855 missense possibly damaging 0.88
R3957:Rrnad1 UTSW 3 87926828 missense possibly damaging 0.82
R4651:Rrnad1 UTSW 3 87927672 missense probably benign
R4818:Rrnad1 UTSW 3 87924998 missense probably benign 0.32
R5387:Rrnad1 UTSW 3 87930011 intron probably benign
R5427:Rrnad1 UTSW 3 87924332 unclassified probably benign
R7032:Rrnad1 UTSW 3 87924342 critical splice donor site probably null
R7048:Rrnad1 UTSW 3 87929860 missense probably damaging 1.00
R7953:Rrnad1 UTSW 3 87927648 missense possibly damaging 0.82
R8334:Rrnad1 UTSW 3 87927749 missense possibly damaging 0.46
R8969:Rrnad1 UTSW 3 87929975 intron probably benign
R9110:Rrnad1 UTSW 3 87927671 missense probably benign 0.03
R9142:Rrnad1 UTSW 3 87923888 missense probably benign 0.03
R9181:Rrnad1 UTSW 3 87928085 intron probably benign
R9257:Rrnad1 UTSW 3 87924461 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTCCTAGGCTCTCATAGTCTAACC -3'
(R):5'- ATGTACAAGCCAGAGGAGCC -3'

Sequencing Primer
(F):5'- AGGCTCTCATAGTCTAACCTCCAG -3'
(R):5'- CCAGAGGAGCCCTGAGATG -3'
Posted On 2015-10-08