Incidental Mutation 'R4663:Szt2'
ID 352991
Institutional Source Beutler Lab
Gene Symbol Szt2
Ensembl Gene ENSMUSG00000033253
Gene Name seizure threshold 2
Synonyms
MMRRC Submission 041921-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.612) question?
Stock # R4663 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 118362743-118409273 bp(-) (GRCm38)
Type of Mutation unclassified
DNA Base Change (assembly) A to G at 118377684 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000075406]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000075406
AA Change: V2162A
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: V2162A

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138386
Predicted Effect probably benign
Transcript: ENSMUST00000183402
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,218,455 V1496A probably benign Het
Aqr A T 2: 114,161,666 Y76* probably null Het
Armc5 C A 7: 128,238,545 A140E probably benign Het
Auts2 T C 5: 131,439,638 H947R probably damaging Het
Bag2 T C 1: 33,746,993 T83A probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bean1 A G 8: 104,211,167 Y126C probably damaging Het
Cars T C 7: 143,575,960 E330G probably damaging Het
Ccdc40 A G 11: 119,231,506 I45V probably benign Het
Cd320 G A 17: 33,848,178 G214R probably null Het
Ckm G A 7: 19,419,494 V237M probably damaging Het
Cspg4 T C 9: 56,886,676 V565A possibly damaging Het
Ephb6 A G 6: 41,617,865 Y638C probably damaging Het
Epp13 T G 7: 6,258,625 I35S possibly damaging Het
Fam196a A T 7: 134,899,148 Y409* probably null Het
Fat2 G C 11: 55,296,213 S1269* probably null Het
Fbxo3 T C 2: 104,053,475 V348A probably damaging Het
Gas6 G A 8: 13,470,254 P478L probably damaging Het
Gm11492 T A 11: 87,567,603 Y268N probably damaging Het
Herc1 T C 9: 66,433,378 S1670P probably damaging Het
Hnrnpk C A 13: 58,394,517 R281L probably damaging Het
Ifih1 C A 2: 62,609,219 C488F probably benign Het
Ift172 T C 5: 31,284,215 K192E probably benign Het
Ighv5-9 T A 12: 113,661,820 Q101L probably benign Het
Igkv3-2 G T 6: 70,698,879 M57I probably benign Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
L3mbtl3 T C 10: 26,337,817 Y237C unknown Het
Lats1 G A 10: 7,712,583 C988Y probably damaging Het
Lgals3 T A 14: 47,381,622 probably null Het
Lrrc3b G T 14: 15,358,220 H129N probably benign Het
Lrriq1 T C 10: 103,063,412 H1656R possibly damaging Het
Lypd6 T G 2: 50,173,611 Y43* probably null Het
Mfsd7a T C 5: 108,442,145 M464V probably benign Het
Mical2 A G 7: 112,328,677 D674G possibly damaging Het
Msi1 G A 5: 115,450,275 R284Q probably damaging Het
Mybpc2 T C 7: 44,505,642 E947G probably damaging Het
Nat14 T A 7: 4,924,447 L206Q probably damaging Het
Nup88 A T 11: 70,965,846 probably null Het
Olfr27 A T 9: 39,144,849 I250F probably damaging Het
Olfr727 A G 14: 50,127,482 R302G probably benign Het
Olfr743 A T 14: 50,533,604 Y64F probably damaging Het
Pdcl T C 2: 37,355,766 E75G probably damaging Het
Phf14 A G 6: 11,953,422 I387V possibly damaging Het
Phf3 G A 1: 30,821,215 R845W probably damaging Het
Pm20d1 T C 1: 131,798,602 I59T probably damaging Het
Prkd1 C T 12: 50,419,848 probably null Het
Psmb2 T C 4: 126,677,765 L4P probably damaging Het
Pttg1 T A 11: 43,424,850 K46* probably null Het
Rrnad1 A G 3: 87,927,748 S82P probably damaging Het
Ryr2 T C 13: 11,749,509 H1401R possibly damaging Het
Sh3d19 G A 3: 86,123,263 D696N probably benign Het
Slc16a2 T C X: 103,707,979 T274A probably benign Het
Slc26a6 G A 9: 108,857,907 A335T probably damaging Het
Slc6a5 C A 7: 49,938,398 Y493* probably null Het
Slf1 A T 13: 77,126,604 S37R probably damaging Het
Smoc1 G A 12: 81,167,602 G264S probably damaging Het
Snapc4 T C 2: 26,374,181 E280G possibly damaging Het
Snx25 G A 8: 46,035,579 T913M probably damaging Het
Snx7 T C 3: 117,800,879 T408A probably benign Het
Spdya T A 17: 71,578,344 S264R probably benign Het
Spg11 A T 2: 122,098,099 probably null Het
Suz12 T A 11: 80,013,524 L230Q probably damaging Het
Tenm3 C A 8: 48,235,970 R2194L probably damaging Het
Tmed8 T A 12: 87,174,231 I194F probably damaging Het
Tmem79 T A 3: 88,333,444 T66S probably damaging Het
Trappc1 T A 11: 69,325,511 S118T probably benign Het
Ttn C T 2: 76,738,881 V27223I probably benign Het
Ttn T C 2: 76,776,495 T18024A probably damaging Het
Vmn2r15 C T 5: 109,294,074 M164I probably benign Het
Vmn2r53 T A 7: 12,600,974 Y253F probably benign Het
Wdr92 T C 11: 17,232,853 V338A probably benign Het
Zfand6 C T 7: 84,617,885 R163H probably benign Het
Other mutations in Szt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Szt2 APN 4 118384250 splice site probably benign
IGL01082:Szt2 APN 4 118397624 missense probably damaging 1.00
IGL01348:Szt2 APN 4 118393624 splice site probably benign
IGL01869:Szt2 APN 4 118399071 missense possibly damaging 0.87
IGL01918:Szt2 APN 4 118384253 splice site probably benign
IGL01951:Szt2 APN 4 118376493 unclassified probably benign
IGL01971:Szt2 APN 4 118386955 missense probably benign 0.01
IGL02047:Szt2 APN 4 118376637 unclassified probably benign
IGL02092:Szt2 APN 4 118363332 unclassified probably benign
IGL02120:Szt2 APN 4 118388564 missense probably benign 0.01
IGL02210:Szt2 APN 4 118389823 missense possibly damaging 0.95
IGL02435:Szt2 APN 4 118390823 missense probably damaging 1.00
IGL02622:Szt2 APN 4 118392890 missense probably damaging 0.96
IGL02666:Szt2 APN 4 118374055 missense probably damaging 0.99
IGL02712:Szt2 APN 4 118384833 missense probably benign 0.19
IGL02983:Szt2 APN 4 118365779 unclassified probably benign
IGL03026:Szt2 APN 4 118391849 missense probably benign 0.40
IGL03178:Szt2 APN 4 118382689 missense unknown
IGL03233:Szt2 APN 4 118372529 missense unknown
IGL03377:Szt2 APN 4 118402397 splice site probably benign
IGL03387:Szt2 APN 4 118364725 unclassified probably benign
PIT4687001:Szt2 UTSW 4 118398201 missense possibly damaging 0.84
R0026:Szt2 UTSW 4 118384772 missense possibly damaging 0.92
R0352:Szt2 UTSW 4 118382593 missense unknown
R0396:Szt2 UTSW 4 118376347 unclassified probably benign
R0504:Szt2 UTSW 4 118372952 splice site probably null
R1033:Szt2 UTSW 4 118387106 missense probably damaging 0.98
R1222:Szt2 UTSW 4 118405459 missense possibly damaging 0.77
R1418:Szt2 UTSW 4 118387779 missense probably benign 0.03
R1462:Szt2 UTSW 4 118373967 missense unknown
R1462:Szt2 UTSW 4 118373967 missense unknown
R1763:Szt2 UTSW 4 118372368 missense unknown
R1772:Szt2 UTSW 4 118405517 missense probably damaging 1.00
R1840:Szt2 UTSW 4 118365657 unclassified probably benign
R1942:Szt2 UTSW 4 118392620 missense probably benign 0.17
R1965:Szt2 UTSW 4 118383965 missense probably benign 0.36
R1998:Szt2 UTSW 4 118375727 critical splice donor site probably null
R2009:Szt2 UTSW 4 118378064 critical splice donor site probably null
R2012:Szt2 UTSW 4 118363665 unclassified probably benign
R2044:Szt2 UTSW 4 118376448 nonsense probably null
R2066:Szt2 UTSW 4 118373980 missense unknown
R2345:Szt2 UTSW 4 118381397 missense unknown
R2857:Szt2 UTSW 4 118369402 missense probably damaging 1.00
R3156:Szt2 UTSW 4 118402819 critical splice donor site probably null
R3236:Szt2 UTSW 4 118383034 splice site probably null
R3237:Szt2 UTSW 4 118383034 splice site probably null
R3405:Szt2 UTSW 4 118394020 missense probably benign 0.02
R3795:Szt2 UTSW 4 118391730 missense probably damaging 1.00
R3878:Szt2 UTSW 4 118390585 missense probably damaging 1.00
R3906:Szt2 UTSW 4 118378269 unclassified probably benign
R4012:Szt2 UTSW 4 118383900 missense probably benign 0.02
R4039:Szt2 UTSW 4 118364952 unclassified probably benign
R4081:Szt2 UTSW 4 118373567 splice site probably benign
R4298:Szt2 UTSW 4 118365406 unclassified probably benign
R4299:Szt2 UTSW 4 118365406 unclassified probably benign
R4432:Szt2 UTSW 4 118384231 missense probably damaging 0.99
R4597:Szt2 UTSW 4 118372681 missense unknown
R4657:Szt2 UTSW 4 118397669 missense probably benign 0.06
R4670:Szt2 UTSW 4 118375829 unclassified probably benign
R4704:Szt2 UTSW 4 118393829 missense probably damaging 0.99
R4748:Szt2 UTSW 4 118389191 nonsense probably null
R4786:Szt2 UTSW 4 118399062 missense probably benign 0.20
R4809:Szt2 UTSW 4 118388985 missense probably damaging 1.00
R4830:Szt2 UTSW 4 118369248 missense unknown
R4944:Szt2 UTSW 4 118388669 missense probably benign 0.03
R5077:Szt2 UTSW 4 118369616 critical splice donor site probably null
R5121:Szt2 UTSW 4 118385444 missense possibly damaging 0.92
R5140:Szt2 UTSW 4 118386981 missense possibly damaging 0.46
R5169:Szt2 UTSW 4 118389830 missense probably benign 0.26
R5198:Szt2 UTSW 4 118388322 missense probably benign 0.03
R5433:Szt2 UTSW 4 118375466 unclassified probably benign
R5625:Szt2 UTSW 4 118373217 missense unknown
R5628:Szt2 UTSW 4 118373217 missense unknown
R5630:Szt2 UTSW 4 118392905 missense possibly damaging 0.83
R5808:Szt2 UTSW 4 118372613 missense unknown
R5902:Szt2 UTSW 4 118391503 missense probably benign 0.05
R6049:Szt2 UTSW 4 118402988 missense probably damaging 0.99
R6066:Szt2 UTSW 4 118371974 missense unknown
R6272:Szt2 UTSW 4 118374290 unclassified probably benign
R6456:Szt2 UTSW 4 118376697 unclassified probably benign
R6538:Szt2 UTSW 4 118390477 splice site probably null
R6604:Szt2 UTSW 4 118385474 missense probably benign 0.01
R6664:Szt2 UTSW 4 118391745 missense probably damaging 1.00
R6834:Szt2 UTSW 4 118388325 missense probably benign 0.01
R7109:Szt2 UTSW 4 118375479 missense unknown
R7163:Szt2 UTSW 4 118405530 missense possibly damaging 0.90
R7190:Szt2 UTSW 4 118389006 missense probably damaging 0.98
R7289:Szt2 UTSW 4 118375878 missense unknown
R7291:Szt2 UTSW 4 118391249 missense probably damaging 0.98
R7383:Szt2 UTSW 4 118365214 nonsense probably null
R7448:Szt2 UTSW 4 118363471 missense unknown
R7637:Szt2 UTSW 4 118393828 missense probably damaging 0.99
R7833:Szt2 UTSW 4 118366219 missense unknown
R7896:Szt2 UTSW 4 118402913 missense possibly damaging 0.62
R7923:Szt2 UTSW 4 118373840 missense unknown
R8090:Szt2 UTSW 4 118387002 splice site probably null
R8103:Szt2 UTSW 4 118387864 missense possibly damaging 0.88
R8288:Szt2 UTSW 4 118389776 missense probably damaging 0.96
R8309:Szt2 UTSW 4 118375482 frame shift probably null
R8341:Szt2 UTSW 4 118392836 missense possibly damaging 0.63
R8480:Szt2 UTSW 4 118386818 missense probably benign 0.01
R8497:Szt2 UTSW 4 118388321 missense possibly damaging 0.94
R8549:Szt2 UTSW 4 118372681 missense unknown
R8768:Szt2 UTSW 4 118369416 missense unknown
R8992:Szt2 UTSW 4 118382788 splice site probably benign
R9001:Szt2 UTSW 4 118378332 missense unknown
R9094:Szt2 UTSW 4 118385454 missense possibly damaging 0.74
R9110:Szt2 UTSW 4 118385433 missense possibly damaging 0.89
R9129:Szt2 UTSW 4 118364669 missense unknown
R9184:Szt2 UTSW 4 118384529 missense possibly damaging 0.92
R9186:Szt2 UTSW 4 118385091 missense probably damaging 1.00
R9424:Szt2 UTSW 4 118390954 missense probably damaging 1.00
R9598:Szt2 UTSW 4 118409161 critical splice donor site probably null
X0023:Szt2 UTSW 4 118372404 missense unknown
Z1176:Szt2 UTSW 4 118393976 missense probably damaging 0.99
Z1177:Szt2 UTSW 4 118391214 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTACACCTCTGGTCTCAGG -3'
(R):5'- AAGAACCCATTTCCTCTGAGG -3'

Sequencing Primer
(F):5'- GTCTCAGGTCAGCTGTGCTC -3'
(R):5'- TCTGAGGATTCCGTGGCAC -3'
Posted On 2015-10-08