Incidental Mutation 'R4663:Szt2'
ID 352991
Institutional Source Beutler Lab
Gene Symbol Szt2
Ensembl Gene ENSMUSG00000033253
Gene Name SZT2 subunit of KICSTOR complex
Synonyms seaizure threshold 2
MMRRC Submission 041921-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.649) question?
Stock # R4663 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 118219940-118266470 bp(-) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) A to G at 118234881 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000075406]
AlphaFold no structure available at present
Predicted Effect unknown
Transcript: ENSMUST00000075406
AA Change: V2162A
SMART Domains Protein: ENSMUSP00000074862
Gene: ENSMUSG00000033253
AA Change: V2162A

DomainStartEndE-ValueType
low complexity region 48 64 N/A INTRINSIC
Blast:VWA 93 343 1e-109 BLAST
low complexity region 704 728 N/A INTRINSIC
low complexity region 762 775 N/A INTRINSIC
low complexity region 779 793 N/A INTRINSIC
low complexity region 875 887 N/A INTRINSIC
low complexity region 994 1011 N/A INTRINSIC
low complexity region 1351 1370 N/A INTRINSIC
low complexity region 1619 1630 N/A INTRINSIC
low complexity region 1662 1678 N/A INTRINSIC
low complexity region 1832 1854 N/A INTRINSIC
low complexity region 1862 1881 N/A INTRINSIC
low complexity region 1895 1914 N/A INTRINSIC
low complexity region 2176 2184 N/A INTRINSIC
low complexity region 2284 2292 N/A INTRINSIC
low complexity region 2309 2323 N/A INTRINSIC
low complexity region 2373 2384 N/A INTRINSIC
low complexity region 2500 2508 N/A INTRINSIC
low complexity region 2669 2680 N/A INTRINSIC
low complexity region 2739 2758 N/A INTRINSIC
low complexity region 3239 3252 N/A INTRINSIC
low complexity region 3257 3268 N/A INTRINSIC
low complexity region 3283 3309 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138386
Predicted Effect probably benign
Transcript: ENSMUST00000183402
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein associated with low seizure threshold in mice and may contribute to susceptibility to epilepsy. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for mutations in this gene display increased susceptibility to induced seizures. Mice homozygous for null mutations also display partial penetrance of prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqr A T 2: 113,992,147 (GRCm39) Y76* probably null Het
Armc5 C A 7: 127,837,717 (GRCm39) A140E probably benign Het
Auts2 T C 5: 131,468,476 (GRCm39) H947R probably damaging Het
Bag2 T C 1: 33,786,074 (GRCm39) T83A probably damaging Het
Bag4 C T 8: 26,259,516 (GRCm39) A228T probably benign Het
Bean1 A G 8: 104,937,799 (GRCm39) Y126C probably damaging Het
Cars1 T C 7: 143,129,697 (GRCm39) E330G probably damaging Het
Ccdc40 A G 11: 119,122,332 (GRCm39) I45V probably benign Het
Cd320 G A 17: 34,067,152 (GRCm39) G214R probably null Het
Ckm G A 7: 19,153,419 (GRCm39) V237M probably damaging Het
Cplane1 T C 15: 8,247,939 (GRCm39) V1496A probably benign Het
Cspg4 T C 9: 56,793,960 (GRCm39) V565A possibly damaging Het
Dnaaf10 T C 11: 17,182,853 (GRCm39) V338A probably benign Het
Eddm13 T G 7: 6,261,624 (GRCm39) I35S possibly damaging Het
Ephb6 A G 6: 41,594,799 (GRCm39) Y638C probably damaging Het
Fat2 G C 11: 55,187,039 (GRCm39) S1269* probably null Het
Fbxo3 T C 2: 103,883,820 (GRCm39) V348A probably damaging Het
Gas6 G A 8: 13,520,254 (GRCm39) P478L probably damaging Het
Herc1 T C 9: 66,340,660 (GRCm39) S1670P probably damaging Het
Hnrnpk C A 13: 58,542,331 (GRCm39) R281L probably damaging Het
Ifih1 C A 2: 62,439,563 (GRCm39) C488F probably benign Het
Ift172 T C 5: 31,441,559 (GRCm39) K192E probably benign Het
Ighv5-9 T A 12: 113,625,440 (GRCm39) Q101L probably benign Het
Igkv3-2 G T 6: 70,675,863 (GRCm39) M57I probably benign Het
Insyn2a A T 7: 134,500,877 (GRCm39) Y409* probably null Het
Itpr2 A G 6: 146,274,671 (GRCm39) F837S probably damaging Het
L3mbtl3 T C 10: 26,213,715 (GRCm39) Y237C unknown Het
Lats1 G A 10: 7,588,347 (GRCm39) C988Y probably damaging Het
Lgals3 T A 14: 47,619,079 (GRCm39) probably null Het
Lrrc3b G T 14: 15,358,220 (GRCm38) H129N probably benign Het
Lrriq1 T C 10: 102,899,273 (GRCm39) H1656R possibly damaging Het
Lypd6 T G 2: 50,063,623 (GRCm39) Y43* probably null Het
Mettl25b A G 3: 87,835,055 (GRCm39) S82P probably damaging Het
Mical2 A G 7: 111,927,884 (GRCm39) D674G possibly damaging Het
Msi1 G A 5: 115,588,334 (GRCm39) R284Q probably damaging Het
Mybpc2 T C 7: 44,155,066 (GRCm39) E947G probably damaging Het
Nat14 T A 7: 4,927,446 (GRCm39) L206Q probably damaging Het
Nup88 A T 11: 70,856,672 (GRCm39) probably null Het
Or11g27 A T 14: 50,771,061 (GRCm39) Y64F probably damaging Het
Or4k15 A G 14: 50,364,939 (GRCm39) R302G probably benign Het
Or8g19 A T 9: 39,056,145 (GRCm39) I250F probably damaging Het
Pdcl T C 2: 37,245,778 (GRCm39) E75G probably damaging Het
Phf14 A G 6: 11,953,421 (GRCm39) I387V possibly damaging Het
Phf3 G A 1: 30,860,296 (GRCm39) R845W probably damaging Het
Pm20d1 T C 1: 131,726,340 (GRCm39) I59T probably damaging Het
Prkd1 C T 12: 50,466,631 (GRCm39) probably null Het
Psmb2 T C 4: 126,571,558 (GRCm39) L4P probably damaging Het
Pttg1 T A 11: 43,315,677 (GRCm39) K46* probably null Het
Ryr2 T C 13: 11,764,395 (GRCm39) H1401R possibly damaging Het
Septin4 T A 11: 87,458,429 (GRCm39) Y268N probably damaging Het
Sh3d19 G A 3: 86,030,570 (GRCm39) D696N probably benign Het
Slc16a2 T C X: 102,751,585 (GRCm39) T274A probably benign Het
Slc26a6 G A 9: 108,735,106 (GRCm39) A335T probably damaging Het
Slc49a3 T C 5: 108,590,011 (GRCm39) M464V probably benign Het
Slc6a5 C A 7: 49,588,146 (GRCm39) Y493* probably null Het
Slf1 A T 13: 77,274,723 (GRCm39) S37R probably damaging Het
Smoc1 G A 12: 81,214,376 (GRCm39) G264S probably damaging Het
Snapc4 T C 2: 26,264,193 (GRCm39) E280G possibly damaging Het
Snx25 G A 8: 46,488,616 (GRCm39) T913M probably damaging Het
Snx7 T C 3: 117,594,528 (GRCm39) T408A probably benign Het
Spdya T A 17: 71,885,339 (GRCm39) S264R probably benign Het
Spg11 A T 2: 121,928,580 (GRCm39) probably null Het
Suz12 T A 11: 79,904,350 (GRCm39) L230Q probably damaging Het
Tenm3 C A 8: 48,689,005 (GRCm39) R2194L probably damaging Het
Tmed8 T A 12: 87,221,005 (GRCm39) I194F probably damaging Het
Tmem79 T A 3: 88,240,751 (GRCm39) T66S probably damaging Het
Trappc1 T A 11: 69,216,337 (GRCm39) S118T probably benign Het
Ttn C T 2: 76,569,225 (GRCm39) V27223I probably benign Het
Ttn T C 2: 76,606,839 (GRCm39) T18024A probably damaging Het
Vmn2r15 C T 5: 109,441,940 (GRCm39) M164I probably benign Het
Vmn2r53 T A 7: 12,334,901 (GRCm39) Y253F probably benign Het
Zfand6 C T 7: 84,267,093 (GRCm39) R163H probably benign Het
Other mutations in Szt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Szt2 APN 4 118,241,447 (GRCm39) splice site probably benign
IGL01082:Szt2 APN 4 118,254,821 (GRCm39) missense probably damaging 1.00
IGL01348:Szt2 APN 4 118,250,821 (GRCm39) splice site probably benign
IGL01869:Szt2 APN 4 118,256,268 (GRCm39) missense possibly damaging 0.87
IGL01918:Szt2 APN 4 118,241,450 (GRCm39) splice site probably benign
IGL01951:Szt2 APN 4 118,233,690 (GRCm39) unclassified probably benign
IGL01971:Szt2 APN 4 118,244,152 (GRCm39) missense probably benign 0.01
IGL02047:Szt2 APN 4 118,233,834 (GRCm39) unclassified probably benign
IGL02092:Szt2 APN 4 118,220,529 (GRCm39) unclassified probably benign
IGL02120:Szt2 APN 4 118,245,761 (GRCm39) missense probably benign 0.01
IGL02210:Szt2 APN 4 118,247,020 (GRCm39) missense possibly damaging 0.95
IGL02435:Szt2 APN 4 118,248,020 (GRCm39) missense probably damaging 1.00
IGL02622:Szt2 APN 4 118,250,087 (GRCm39) missense probably damaging 0.96
IGL02666:Szt2 APN 4 118,231,252 (GRCm39) missense probably damaging 0.99
IGL02712:Szt2 APN 4 118,242,030 (GRCm39) missense probably benign 0.19
IGL02983:Szt2 APN 4 118,222,976 (GRCm39) unclassified probably benign
IGL03026:Szt2 APN 4 118,249,046 (GRCm39) missense probably benign 0.40
IGL03178:Szt2 APN 4 118,239,886 (GRCm39) missense unknown
IGL03233:Szt2 APN 4 118,229,726 (GRCm39) missense unknown
IGL03377:Szt2 APN 4 118,259,594 (GRCm39) splice site probably benign
IGL03387:Szt2 APN 4 118,221,922 (GRCm39) unclassified probably benign
PIT4687001:Szt2 UTSW 4 118,255,398 (GRCm39) missense possibly damaging 0.84
R0026:Szt2 UTSW 4 118,241,969 (GRCm39) missense possibly damaging 0.92
R0352:Szt2 UTSW 4 118,239,790 (GRCm39) missense unknown
R0396:Szt2 UTSW 4 118,233,544 (GRCm39) unclassified probably benign
R0504:Szt2 UTSW 4 118,230,149 (GRCm39) splice site probably null
R1033:Szt2 UTSW 4 118,244,303 (GRCm39) missense probably damaging 0.98
R1222:Szt2 UTSW 4 118,262,656 (GRCm39) missense possibly damaging 0.77
R1418:Szt2 UTSW 4 118,244,976 (GRCm39) missense probably benign 0.03
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1462:Szt2 UTSW 4 118,231,164 (GRCm39) missense unknown
R1763:Szt2 UTSW 4 118,229,565 (GRCm39) missense unknown
R1772:Szt2 UTSW 4 118,262,714 (GRCm39) missense probably damaging 1.00
R1840:Szt2 UTSW 4 118,222,854 (GRCm39) unclassified probably benign
R1942:Szt2 UTSW 4 118,249,817 (GRCm39) missense probably benign 0.17
R1965:Szt2 UTSW 4 118,241,162 (GRCm39) missense probably benign 0.36
R1998:Szt2 UTSW 4 118,232,924 (GRCm39) critical splice donor site probably null
R2009:Szt2 UTSW 4 118,235,261 (GRCm39) critical splice donor site probably null
R2012:Szt2 UTSW 4 118,220,862 (GRCm39) unclassified probably benign
R2044:Szt2 UTSW 4 118,233,645 (GRCm39) nonsense probably null
R2066:Szt2 UTSW 4 118,231,177 (GRCm39) missense unknown
R2345:Szt2 UTSW 4 118,238,594 (GRCm39) missense unknown
R2857:Szt2 UTSW 4 118,226,599 (GRCm39) missense probably damaging 1.00
R3156:Szt2 UTSW 4 118,260,016 (GRCm39) critical splice donor site probably null
R3236:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3237:Szt2 UTSW 4 118,240,231 (GRCm39) splice site probably null
R3405:Szt2 UTSW 4 118,251,217 (GRCm39) missense probably benign 0.02
R3795:Szt2 UTSW 4 118,248,927 (GRCm39) missense probably damaging 1.00
R3878:Szt2 UTSW 4 118,247,782 (GRCm39) missense probably damaging 1.00
R3906:Szt2 UTSW 4 118,235,466 (GRCm39) unclassified probably benign
R4012:Szt2 UTSW 4 118,241,097 (GRCm39) missense probably benign 0.02
R4039:Szt2 UTSW 4 118,222,149 (GRCm39) unclassified probably benign
R4081:Szt2 UTSW 4 118,230,764 (GRCm39) splice site probably benign
R4298:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4299:Szt2 UTSW 4 118,222,603 (GRCm39) unclassified probably benign
R4432:Szt2 UTSW 4 118,241,428 (GRCm39) missense probably damaging 0.99
R4597:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R4657:Szt2 UTSW 4 118,254,866 (GRCm39) missense probably benign 0.06
R4670:Szt2 UTSW 4 118,233,026 (GRCm39) unclassified probably benign
R4704:Szt2 UTSW 4 118,251,026 (GRCm39) missense probably damaging 0.99
R4748:Szt2 UTSW 4 118,246,388 (GRCm39) nonsense probably null
R4786:Szt2 UTSW 4 118,256,259 (GRCm39) missense probably benign 0.20
R4809:Szt2 UTSW 4 118,246,182 (GRCm39) missense probably damaging 1.00
R4830:Szt2 UTSW 4 118,226,445 (GRCm39) missense unknown
R4944:Szt2 UTSW 4 118,245,866 (GRCm39) missense probably benign 0.03
R5077:Szt2 UTSW 4 118,226,813 (GRCm39) critical splice donor site probably null
R5121:Szt2 UTSW 4 118,242,641 (GRCm39) missense possibly damaging 0.92
R5140:Szt2 UTSW 4 118,244,178 (GRCm39) missense possibly damaging 0.46
R5169:Szt2 UTSW 4 118,247,027 (GRCm39) missense probably benign 0.26
R5198:Szt2 UTSW 4 118,245,519 (GRCm39) missense probably benign 0.03
R5433:Szt2 UTSW 4 118,232,663 (GRCm39) unclassified probably benign
R5625:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5628:Szt2 UTSW 4 118,230,414 (GRCm39) missense unknown
R5630:Szt2 UTSW 4 118,250,102 (GRCm39) missense possibly damaging 0.83
R5808:Szt2 UTSW 4 118,229,810 (GRCm39) missense unknown
R5902:Szt2 UTSW 4 118,248,700 (GRCm39) missense probably benign 0.05
R6049:Szt2 UTSW 4 118,260,185 (GRCm39) missense probably damaging 0.99
R6066:Szt2 UTSW 4 118,229,171 (GRCm39) missense unknown
R6272:Szt2 UTSW 4 118,231,487 (GRCm39) unclassified probably benign
R6456:Szt2 UTSW 4 118,233,894 (GRCm39) unclassified probably benign
R6538:Szt2 UTSW 4 118,247,674 (GRCm39) splice site probably null
R6604:Szt2 UTSW 4 118,242,671 (GRCm39) missense probably benign 0.01
R6664:Szt2 UTSW 4 118,248,942 (GRCm39) missense probably damaging 1.00
R6834:Szt2 UTSW 4 118,245,522 (GRCm39) missense probably benign 0.01
R7109:Szt2 UTSW 4 118,232,676 (GRCm39) missense unknown
R7163:Szt2 UTSW 4 118,262,727 (GRCm39) missense possibly damaging 0.90
R7190:Szt2 UTSW 4 118,246,203 (GRCm39) missense probably damaging 0.98
R7289:Szt2 UTSW 4 118,233,075 (GRCm39) missense unknown
R7291:Szt2 UTSW 4 118,248,446 (GRCm39) missense probably damaging 0.98
R7383:Szt2 UTSW 4 118,222,411 (GRCm39) nonsense probably null
R7448:Szt2 UTSW 4 118,220,668 (GRCm39) missense unknown
R7637:Szt2 UTSW 4 118,251,025 (GRCm39) missense probably damaging 0.99
R7833:Szt2 UTSW 4 118,223,416 (GRCm39) missense unknown
R7896:Szt2 UTSW 4 118,260,110 (GRCm39) missense possibly damaging 0.62
R7923:Szt2 UTSW 4 118,231,037 (GRCm39) missense unknown
R8090:Szt2 UTSW 4 118,244,199 (GRCm39) splice site probably null
R8103:Szt2 UTSW 4 118,245,061 (GRCm39) missense possibly damaging 0.88
R8288:Szt2 UTSW 4 118,246,973 (GRCm39) missense probably damaging 0.96
R8309:Szt2 UTSW 4 118,232,679 (GRCm39) frame shift probably null
R8341:Szt2 UTSW 4 118,250,033 (GRCm39) missense possibly damaging 0.63
R8480:Szt2 UTSW 4 118,244,015 (GRCm39) missense probably benign 0.01
R8497:Szt2 UTSW 4 118,245,518 (GRCm39) missense possibly damaging 0.94
R8549:Szt2 UTSW 4 118,229,878 (GRCm39) missense unknown
R8768:Szt2 UTSW 4 118,226,613 (GRCm39) missense unknown
R8992:Szt2 UTSW 4 118,239,985 (GRCm39) splice site probably benign
R9001:Szt2 UTSW 4 118,235,529 (GRCm39) missense unknown
R9094:Szt2 UTSW 4 118,242,651 (GRCm39) missense possibly damaging 0.74
R9110:Szt2 UTSW 4 118,242,630 (GRCm39) missense possibly damaging 0.89
R9129:Szt2 UTSW 4 118,221,866 (GRCm39) missense unknown
R9184:Szt2 UTSW 4 118,241,726 (GRCm39) missense possibly damaging 0.92
R9186:Szt2 UTSW 4 118,242,288 (GRCm39) missense probably damaging 1.00
R9424:Szt2 UTSW 4 118,248,151 (GRCm39) missense probably damaging 1.00
R9598:Szt2 UTSW 4 118,266,358 (GRCm39) critical splice donor site probably null
X0023:Szt2 UTSW 4 118,229,601 (GRCm39) missense unknown
Z1176:Szt2 UTSW 4 118,251,173 (GRCm39) missense probably damaging 0.99
Z1177:Szt2 UTSW 4 118,248,411 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTACACCTCTGGTCTCAGG -3'
(R):5'- AAGAACCCATTTCCTCTGAGG -3'

Sequencing Primer
(F):5'- GTCTCAGGTCAGCTGTGCTC -3'
(R):5'- TCTGAGGATTCCGTGGCAC -3'
Posted On 2015-10-08