Mutagenetix > Incidental Mutation

Incidental Mutation 'R4663:Ephb6'

352999

Institutional Source

Beutler Lab

Gene Symbol

Ephb6

Ensembl Gene

ENSMUSG00000029869

Gene Name

Eph receptor B6

Synonyms

Cekl, Mep

MMRRC Submission

041921-MU

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.675) question?

Stock #

R4663 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

41605482-41620509 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 41617865 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 638 (Y638C)

Ref Sequence

ENSEMBL: ENSMUSP00000110380 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031902] [ENSMUST00000114732] [ENSMUST00000201471]

AlphaFold

O08644

Predicted Effect

probably benign
Transcript: ENSMUST00000031902

SMART Domains

Protein: ENSMUSP00000031902
Gene: ENSMUSG00000029868

Domain	Start	End	E-Value	Type
ANK	44	74	2.39e2	SMART
ANK	78	107	6.17e-1	SMART
ANK	116	145	3.06e-5	SMART
ANK	162	191	1.85e-4	SMART
Blast:ANK	195	223	3e-10	BLAST
ANK	238	267	2.47e2	SMART
Pfam:Ion_trans	327	589	9.8e-18	PFAM
low complexity region	680	695	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000114732
AA Change: Y638C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000110380
Gene: ENSMUSG00000029869
AA Change: Y638C

Domain	Start	End	E-Value	Type
signal peptide	1	32	N/A	INTRINSIC
EPH_lbd	34	227	2.18e-100	SMART
low complexity region	242	255	N/A	INTRINSIC
Pfam:GCC2_GCC3	299	341	1.9e-9	PFAM
FN3	365	462	3.59e-3	SMART
FN3	481	562	3.73e-10	SMART
Pfam:EphA2_TM	589	660	3.4e-16	PFAM
Pfam:Pkinase	663	908	1.4e-29	PFAM
Pfam:Pkinase_Tyr	663	908	1.1e-67	PFAM
SAM	938	1005	1e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167082

Predicted Effect

probably benign
Transcript: ENSMUST00000167497

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170624

Predicted Effect

probably benign
Transcript: ENSMUST00000201471

SMART Domains

Protein: ENSMUSP00000143854
Gene: ENSMUSG00000029868

Domain	Start	End	E-Value	Type
ANK	44	74	2.39e2	SMART
ANK	78	107	6.17e-1	SMART
ANK	116	145	3.06e-5	SMART
ANK	162	191	1.85e-4	SMART
Blast:ANK	195	223	3e-10	BLAST
ANK	238	267	2.47e2	SMART
Pfam:Ion_trans	327	589	9.8e-18	PFAM
low complexity region	680	695	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of transmembrane proteins that function as receptors for ephrin-B family proteins. Unlike other members of this family, the encoded protein does not contain a functional kinase domain. Activity of this protein can influence cell adhesion and migration. Expression of this gene is downregulated during tumor progression, suggesting that the protein may suppress tumor invasion and metastasis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: T cell responses such as lymphokine secretion, proliferation, and the development of delayed-type skin hypersensitivity and experimental autoimmune encephalitis were compromised in homozygous null mutants. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,218,455	V1496A	probably benign	Het
Aqr	A	T	2: 114,161,666	Y76*	probably null	Het
Armc5	C	A	7: 128,238,545	A140E	probably benign	Het
Auts2	T	C	5: 131,439,638	H947R	probably damaging	Het
Bag2	T	C	1: 33,746,993	T83A	probably damaging	Het
Bag4	C	T	8: 25,769,488	A228T	probably benign	Het
Bean1	A	G	8: 104,211,167	Y126C	probably damaging	Het
Cars	T	C	7: 143,575,960	E330G	probably damaging	Het
Ccdc40	A	G	11: 119,231,506	I45V	probably benign	Het
Cd320	G	A	17: 33,848,178	G214R	probably null	Het
Ckm	G	A	7: 19,419,494	V237M	probably damaging	Het
Cspg4	T	C	9: 56,886,676	V565A	possibly damaging	Het
Epp13	T	G	7: 6,258,625	I35S	possibly damaging	Het
Fam196a	A	T	7: 134,899,148	Y409*	probably null	Het
Fat2	G	C	11: 55,296,213	S1269*	probably null	Het
Fbxo3	T	C	2: 104,053,475	V348A	probably damaging	Het
Gas6	G	A	8: 13,470,254	P478L	probably damaging	Het
Gm11492	T	A	11: 87,567,603	Y268N	probably damaging	Het
Herc1	T	C	9: 66,433,378	S1670P	probably damaging	Het
Hnrnpk	C	A	13: 58,394,517	R281L	probably damaging	Het
Ifih1	C	A	2: 62,609,219	C488F	probably benign	Het
Ift172	T	C	5: 31,284,215	K192E	probably benign	Het
Ighv5-9	T	A	12: 113,661,820	Q101L	probably benign	Het
Igkv3-2	G	T	6: 70,698,879	M57I	probably benign	Het
Itpr2	A	G	6: 146,373,173	F837S	probably damaging	Het
L3mbtl3	T	C	10: 26,337,817	Y237C	unknown	Het
Lats1	G	A	10: 7,712,583	C988Y	probably damaging	Het
Lgals3	T	A	14: 47,381,622		probably null	Het
Lrrc3b	G	T	14: 15,358,220	H129N	probably benign	Het
Lrriq1	T	C	10: 103,063,412	H1656R	possibly damaging	Het
Lypd6	T	G	2: 50,173,611	Y43*	probably null	Het
Mfsd7a	T	C	5: 108,442,145	M464V	probably benign	Het
Mical2	A	G	7: 112,328,677	D674G	possibly damaging	Het
Msi1	G	A	5: 115,450,275	R284Q	probably damaging	Het
Mybpc2	T	C	7: 44,505,642	E947G	probably damaging	Het
Nat14	T	A	7: 4,924,447	L206Q	probably damaging	Het
Nup88	A	T	11: 70,965,846		probably null	Het
Olfr27	A	T	9: 39,144,849	I250F	probably damaging	Het
Olfr727	A	G	14: 50,127,482	R302G	probably benign	Het
Olfr743	A	T	14: 50,533,604	Y64F	probably damaging	Het
Pdcl	T	C	2: 37,355,766	E75G	probably damaging	Het
Phf14	A	G	6: 11,953,422	I387V	possibly damaging	Het
Phf3	G	A	1: 30,821,215	R845W	probably damaging	Het
Pm20d1	T	C	1: 131,798,602	I59T	probably damaging	Het
Prkd1	C	T	12: 50,419,848		probably null	Het
Psmb2	T	C	4: 126,677,765	L4P	probably damaging	Het
Pttg1	T	A	11: 43,424,850	K46*	probably null	Het
Rrnad1	A	G	3: 87,927,748	S82P	probably damaging	Het
Ryr2	T	C	13: 11,749,509	H1401R	possibly damaging	Het
Sh3d19	G	A	3: 86,123,263	D696N	probably benign	Het
Slc16a2	T	C	X: 103,707,979	T274A	probably benign	Het
Slc26a6	G	A	9: 108,857,907	A335T	probably damaging	Het
Slc6a5	C	A	7: 49,938,398	Y493*	probably null	Het
Slf1	A	T	13: 77,126,604	S37R	probably damaging	Het
Smoc1	G	A	12: 81,167,602	G264S	probably damaging	Het
Snapc4	T	C	2: 26,374,181	E280G	possibly damaging	Het
Snx25	G	A	8: 46,035,579	T913M	probably damaging	Het
Snx7	T	C	3: 117,800,879	T408A	probably benign	Het
Spdya	T	A	17: 71,578,344	S264R	probably benign	Het
Spg11	A	T	2: 122,098,099		probably null	Het
Suz12	T	A	11: 80,013,524	L230Q	probably damaging	Het
Szt2	A	G	4: 118,377,684		probably benign	Het
Tenm3	C	A	8: 48,235,970	R2194L	probably damaging	Het
Tmed8	T	A	12: 87,174,231	I194F	probably damaging	Het
Tmem79	T	A	3: 88,333,444	T66S	probably damaging	Het
Trappc1	T	A	11: 69,325,511	S118T	probably benign	Het
Ttn	C	T	2: 76,738,881	V27223I	probably benign	Het
Ttn	T	C	2: 76,776,495	T18024A	probably damaging	Het
Vmn2r15	C	T	5: 109,294,074	M164I	probably benign	Het
Vmn2r53	T	A	7: 12,600,974	Y253F	probably benign	Het
Wdr92	T	C	11: 17,232,853	V338A	probably benign	Het
Zfand6	C	T	7: 84,617,885	R163H	probably benign	Het

Other mutations in Ephb6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Ephb6	APN	6	41615911	unclassified	probably benign
IGL01691:Ephb6	APN	6	41614515	missense	probably benign	0.26
IGL02052:Ephb6	APN	6	41613322	missense	probably benign
IGL02079:Ephb6	APN	6	41616014	missense	possibly damaging	0.57
IGL03089:Ephb6	APN	6	41614174	missense	probably damaging	1.00
P4748:Ephb6	UTSW	6	41617285	missense	probably damaging	0.96
R0022:Ephb6	UTSW	6	41614569	missense	probably damaging	0.98
R0022:Ephb6	UTSW	6	41614569	missense	probably damaging	0.98
R0106:Ephb6	UTSW	6	41619594	unclassified	probably benign
R0106:Ephb6	UTSW	6	41619594	unclassified	probably benign
R0973:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R0973:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R0974:Ephb6	UTSW	6	41614104	missense	probably damaging	0.98
R1465:Ephb6	UTSW	6	41616106	missense	probably damaging	1.00
R1465:Ephb6	UTSW	6	41616106	missense	probably damaging	1.00
R1610:Ephb6	UTSW	6	41614373	nonsense	probably null
R1658:Ephb6	UTSW	6	41614245	missense	probably damaging	1.00
R1687:Ephb6	UTSW	6	41617366	missense	probably benign	0.08
R1733:Ephb6	UTSW	6	41619720	missense	probably benign	0.10
R2191:Ephb6	UTSW	6	41616085	missense	possibly damaging	0.82
R2439:Ephb6	UTSW	6	41618735	missense	probably benign	0.31
R2915:Ephb6	UTSW	6	41614238	missense	probably damaging	1.00
R3020:Ephb6	UTSW	6	41614521	missense	probably damaging	1.00
R3499:Ephb6	UTSW	6	41616159	nonsense	probably null
R4606:Ephb6	UTSW	6	41616574	missense	probably benign	0.15
R4668:Ephb6	UTSW	6	41614602	missense	possibly damaging	0.91
R4762:Ephb6	UTSW	6	41618160	missense	probably damaging	0.99
R4767:Ephb6	UTSW	6	41614185	missense	possibly damaging	0.81
R4780:Ephb6	UTSW	6	41616139	missense	probably damaging	1.00
R4846:Ephb6	UTSW	6	41616809	missense	probably benign
R4851:Ephb6	UTSW	6	41618145	missense	probably benign	0.00
R5016:Ephb6	UTSW	6	41618107	missense	probably benign	0.01
R5122:Ephb6	UTSW	6	41613404	missense	probably benign	0.00
R5313:Ephb6	UTSW	6	41616793	missense	possibly damaging	0.68
R5615:Ephb6	UTSW	6	41619291	missense	probably benign
R5623:Ephb6	UTSW	6	41616481	missense	probably benign	0.20
R5686:Ephb6	UTSW	6	41619704	missense	possibly damaging	0.57
R5840:Ephb6	UTSW	6	41615573	missense	possibly damaging	0.94
R6147:Ephb6	UTSW	6	41616781	missense	probably damaging	1.00
R6645:Ephb6	UTSW	6	41617272	missense	probably benign	0.01
R6730:Ephb6	UTSW	6	41617374	nonsense	probably null
R7412:Ephb6	UTSW	6	41620239	missense	probably damaging	1.00
R7442:Ephb6	UTSW	6	41618047	splice site	probably null
R7759:Ephb6	UTSW	6	41614605	missense	probably benign	0.00
R7857:Ephb6	UTSW	6	41613397	missense	probably benign
R8425:Ephb6	UTSW	6	41618646	missense	probably damaging	0.98
R8697:Ephb6	UTSW	6	41614223	missense	probably damaging	0.99
R8898:Ephb6	UTSW	6	41613359	missense	probably benign
R8959:Ephb6	UTSW	6	41613359	missense	probably benign
R8961:Ephb6	UTSW	6	41613359	missense	probably benign
R8980:Ephb6	UTSW	6	41613359	missense	probably benign
R8989:Ephb6	UTSW	6	41613359	missense	probably benign
R8992:Ephb6	UTSW	6	41613359	missense	probably benign
R9065:Ephb6	UTSW	6	41613359	missense	probably benign
R9413:Ephb6	UTSW	6	41614575	missense
R9512:Ephb6	UTSW	6	41616096	missense	possibly damaging	0.70
R9617:Ephb6	UTSW	6	41619324	missense	probably damaging	1.00
R9619:Ephb6	UTSW	6	41617315	missense	possibly damaging	0.72
R9705:Ephb6	UTSW	6	41619781	missense	probably benign	0.05
R9764:Ephb6	UTSW	6	41615977	missense	probably benign	0.01
X0027:Ephb6	UTSW	6	41620080	makesense	probably null

Predicted Primers

PCR Primer
(F):5'- AATACAGCAGCCCAGGTTGG -3'
(R):5'- CCAAAGGAACCTGGAATAATTGATACC -3'

Sequencing Primer
(F):5'- CCAGGTTGGGAAGGGGAG -3'
(R):5'- CCTGGAATAATTGATACCAACATGG -3'

Posted On

2015-10-08