Incidental Mutation 'R4663:Mical2'
ID 353011
Institutional Source Beutler Lab
Gene Symbol Mical2
Ensembl Gene ENSMUSG00000038244
Gene Name microtubule associated monooxygenase, calponin and LIM domain containing 2
Synonyms 4921517J23Rik, Ebitein1, 5330438E18Rik, Micalcl
MMRRC Submission 041921-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.298) question?
Stock # R4663 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 111825063-112012313 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111927884 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 674 (D674G)
Ref Sequence ENSEMBL: ENSMUSP00000051163 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037991] [ENSMUST00000050149]
AlphaFold Q8BML1
Q9D5U9
Predicted Effect possibly damaging
Transcript: ENSMUST00000037991
AA Change: D674G

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000047639
Gene: ENSMUSG00000038244
AA Change: D674G

DomainStartEndE-ValueType
Pfam:FAD_binding_3 86 143 1e-8 PFAM
Pfam:FAD_binding_2 88 127 3.2e-6 PFAM
low complexity region 175 188 N/A INTRINSIC
low complexity region 500 515 N/A INTRINSIC
CH 518 617 4.14e-17 SMART
low complexity region 691 700 N/A INTRINSIC
low complexity region 894 925 N/A INTRINSIC
LIM 979 1033 9.91e-10 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000050149
AA Change: D674G

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000051163
Gene: ENSMUSG00000038244
AA Change: D674G

DomainStartEndE-ValueType
Pfam:FAD_binding_3 86 143 1.1e-8 PFAM
Pfam:FAD_binding_2 88 127 1.5e-6 PFAM
Pfam:Pyr_redox_2 88 259 1.3e-6 PFAM
low complexity region 500 515 N/A INTRINSIC
CH 518 617 4.14e-17 SMART
low complexity region 691 700 N/A INTRINSIC
LIM 752 806 9.91e-10 SMART
low complexity region 918 926 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106648
SMART Domains Protein: ENSMUSP00000102259
Gene: ENSMUSG00000038244

DomainStartEndE-ValueType
Pfam:FAD_binding_3 86 143 9.5e-9 PFAM
Pfam:FAD_binding_2 88 127 1.3e-6 PFAM
Pfam:Pyr_redox_2 88 263 1e-6 PFAM
low complexity region 500 515 N/A INTRINSIC
CH 518 617 4.14e-17 SMART
low complexity region 691 700 N/A INTRINSIC
LIM 752 806 1.71e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150428
Meta Mutation Damage Score 0.0820 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a monooxygenase that enhances depolymerization of F-actin and is therefore involved in cytoskeletal dynamics. The encoded protein is a regulator of the SRF signaling pathway. Increased expression of this gene has been associated with cancer progression and metastasis. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqr A T 2: 113,992,147 (GRCm39) Y76* probably null Het
Armc5 C A 7: 127,837,717 (GRCm39) A140E probably benign Het
Auts2 T C 5: 131,468,476 (GRCm39) H947R probably damaging Het
Bag2 T C 1: 33,786,074 (GRCm39) T83A probably damaging Het
Bag4 C T 8: 26,259,516 (GRCm39) A228T probably benign Het
Bean1 A G 8: 104,937,799 (GRCm39) Y126C probably damaging Het
Cars1 T C 7: 143,129,697 (GRCm39) E330G probably damaging Het
Ccdc40 A G 11: 119,122,332 (GRCm39) I45V probably benign Het
Cd320 G A 17: 34,067,152 (GRCm39) G214R probably null Het
Ckm G A 7: 19,153,419 (GRCm39) V237M probably damaging Het
Cplane1 T C 15: 8,247,939 (GRCm39) V1496A probably benign Het
Cspg4 T C 9: 56,793,960 (GRCm39) V565A possibly damaging Het
Dnaaf10 T C 11: 17,182,853 (GRCm39) V338A probably benign Het
Eddm13 T G 7: 6,261,624 (GRCm39) I35S possibly damaging Het
Ephb6 A G 6: 41,594,799 (GRCm39) Y638C probably damaging Het
Fat2 G C 11: 55,187,039 (GRCm39) S1269* probably null Het
Fbxo3 T C 2: 103,883,820 (GRCm39) V348A probably damaging Het
Gas6 G A 8: 13,520,254 (GRCm39) P478L probably damaging Het
Herc1 T C 9: 66,340,660 (GRCm39) S1670P probably damaging Het
Hnrnpk C A 13: 58,542,331 (GRCm39) R281L probably damaging Het
Ifih1 C A 2: 62,439,563 (GRCm39) C488F probably benign Het
Ift172 T C 5: 31,441,559 (GRCm39) K192E probably benign Het
Ighv5-9 T A 12: 113,625,440 (GRCm39) Q101L probably benign Het
Igkv3-2 G T 6: 70,675,863 (GRCm39) M57I probably benign Het
Insyn2a A T 7: 134,500,877 (GRCm39) Y409* probably null Het
Itpr2 A G 6: 146,274,671 (GRCm39) F837S probably damaging Het
L3mbtl3 T C 10: 26,213,715 (GRCm39) Y237C unknown Het
Lats1 G A 10: 7,588,347 (GRCm39) C988Y probably damaging Het
Lgals3 T A 14: 47,619,079 (GRCm39) probably null Het
Lrrc3b G T 14: 15,358,220 (GRCm38) H129N probably benign Het
Lrriq1 T C 10: 102,899,273 (GRCm39) H1656R possibly damaging Het
Lypd6 T G 2: 50,063,623 (GRCm39) Y43* probably null Het
Mettl25b A G 3: 87,835,055 (GRCm39) S82P probably damaging Het
Msi1 G A 5: 115,588,334 (GRCm39) R284Q probably damaging Het
Mybpc2 T C 7: 44,155,066 (GRCm39) E947G probably damaging Het
Nat14 T A 7: 4,927,446 (GRCm39) L206Q probably damaging Het
Nup88 A T 11: 70,856,672 (GRCm39) probably null Het
Or11g27 A T 14: 50,771,061 (GRCm39) Y64F probably damaging Het
Or4k15 A G 14: 50,364,939 (GRCm39) R302G probably benign Het
Or8g19 A T 9: 39,056,145 (GRCm39) I250F probably damaging Het
Pdcl T C 2: 37,245,778 (GRCm39) E75G probably damaging Het
Phf14 A G 6: 11,953,421 (GRCm39) I387V possibly damaging Het
Phf3 G A 1: 30,860,296 (GRCm39) R845W probably damaging Het
Pm20d1 T C 1: 131,726,340 (GRCm39) I59T probably damaging Het
Prkd1 C T 12: 50,466,631 (GRCm39) probably null Het
Psmb2 T C 4: 126,571,558 (GRCm39) L4P probably damaging Het
Pttg1 T A 11: 43,315,677 (GRCm39) K46* probably null Het
Ryr2 T C 13: 11,764,395 (GRCm39) H1401R possibly damaging Het
Septin4 T A 11: 87,458,429 (GRCm39) Y268N probably damaging Het
Sh3d19 G A 3: 86,030,570 (GRCm39) D696N probably benign Het
Slc16a2 T C X: 102,751,585 (GRCm39) T274A probably benign Het
Slc26a6 G A 9: 108,735,106 (GRCm39) A335T probably damaging Het
Slc49a3 T C 5: 108,590,011 (GRCm39) M464V probably benign Het
Slc6a5 C A 7: 49,588,146 (GRCm39) Y493* probably null Het
Slf1 A T 13: 77,274,723 (GRCm39) S37R probably damaging Het
Smoc1 G A 12: 81,214,376 (GRCm39) G264S probably damaging Het
Snapc4 T C 2: 26,264,193 (GRCm39) E280G possibly damaging Het
Snx25 G A 8: 46,488,616 (GRCm39) T913M probably damaging Het
Snx7 T C 3: 117,594,528 (GRCm39) T408A probably benign Het
Spdya T A 17: 71,885,339 (GRCm39) S264R probably benign Het
Spg11 A T 2: 121,928,580 (GRCm39) probably null Het
Suz12 T A 11: 79,904,350 (GRCm39) L230Q probably damaging Het
Szt2 A G 4: 118,234,881 (GRCm39) probably benign Het
Tenm3 C A 8: 48,689,005 (GRCm39) R2194L probably damaging Het
Tmed8 T A 12: 87,221,005 (GRCm39) I194F probably damaging Het
Tmem79 T A 3: 88,240,751 (GRCm39) T66S probably damaging Het
Trappc1 T A 11: 69,216,337 (GRCm39) S118T probably benign Het
Ttn C T 2: 76,569,225 (GRCm39) V27223I probably benign Het
Ttn T C 2: 76,606,839 (GRCm39) T18024A probably damaging Het
Vmn2r15 C T 5: 109,441,940 (GRCm39) M164I probably benign Het
Vmn2r53 T A 7: 12,334,901 (GRCm39) Y253F probably benign Het
Zfand6 C T 7: 84,267,093 (GRCm39) R163H probably benign Het
Other mutations in Mical2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00504:Mical2 APN 7 111,981,352 (GRCm39) missense possibly damaging 0.94
IGL00886:Mical2 APN 7 111,914,279 (GRCm39) missense probably benign 0.00
IGL00934:Mical2 APN 7 111,948,610 (GRCm39) missense probably damaging 1.00
IGL00941:Mical2 APN 7 111,920,652 (GRCm39) splice site probably benign
IGL01020:Mical2 APN 7 111,914,283 (GRCm39) splice site probably benign
IGL01395:Mical2 APN 7 111,922,792 (GRCm39) missense probably damaging 1.00
IGL01658:Mical2 APN 7 111,914,205 (GRCm39) missense probably damaging 1.00
IGL01775:Mical2 APN 7 111,981,269 (GRCm39) missense possibly damaging 0.89
IGL02040:Mical2 APN 7 111,910,613 (GRCm39) missense probably damaging 1.00
IGL02051:Mical2 APN 7 111,980,597 (GRCm39) missense probably benign 0.30
IGL02388:Mical2 APN 7 111,934,620 (GRCm39) missense probably benign
IGL02551:Mical2 APN 7 111,923,197 (GRCm39) missense probably benign 0.01
IGL02578:Mical2 APN 7 111,950,580 (GRCm39) missense probably benign 0.05
IGL02751:Mical2 APN 7 111,931,243 (GRCm39) missense probably benign 0.11
IGL03114:Mical2 APN 7 111,996,764 (GRCm39) missense probably damaging 1.00
R0091:Mical2 UTSW 7 111,980,503 (GRCm39) missense probably benign 0.05
R0101:Mical2 UTSW 7 111,936,074 (GRCm39) missense possibly damaging 0.86
R0415:Mical2 UTSW 7 111,980,235 (GRCm39) missense probably damaging 1.00
R0504:Mical2 UTSW 7 111,870,524 (GRCm39) missense probably benign 0.00
R0594:Mical2 UTSW 7 111,917,657 (GRCm39) missense probably damaging 0.97
R0609:Mical2 UTSW 7 111,920,647 (GRCm39) splice site probably null
R0962:Mical2 UTSW 7 111,979,624 (GRCm39) missense probably damaging 0.99
R1521:Mical2 UTSW 7 111,980,817 (GRCm39) missense probably damaging 1.00
R1542:Mical2 UTSW 7 111,908,675 (GRCm39) missense probably damaging 1.00
R1611:Mical2 UTSW 7 111,980,671 (GRCm39) missense probably damaging 0.99
R1740:Mical2 UTSW 7 111,933,043 (GRCm39) missense probably benign
R1815:Mical2 UTSW 7 112,012,109 (GRCm39) missense probably damaging 1.00
R1855:Mical2 UTSW 7 111,944,489 (GRCm39) missense probably benign 0.21
R1958:Mical2 UTSW 7 111,980,311 (GRCm39) missense probably benign 0.00
R1962:Mical2 UTSW 7 112,012,051 (GRCm39) missense probably benign 0.14
R2086:Mical2 UTSW 7 111,917,810 (GRCm39) missense probably benign 0.31
R2136:Mical2 UTSW 7 111,870,722 (GRCm39) missense possibly damaging 0.72
R2418:Mical2 UTSW 7 111,919,941 (GRCm39) critical splice donor site probably null
R2439:Mical2 UTSW 7 111,994,002 (GRCm39) missense probably damaging 0.99
R3053:Mical2 UTSW 7 111,910,630 (GRCm39) missense probably damaging 1.00
R3979:Mical2 UTSW 7 112,006,885 (GRCm39) splice site probably null
R4308:Mical2 UTSW 7 111,931,199 (GRCm39) missense probably benign 0.27
R4551:Mical2 UTSW 7 111,981,123 (GRCm39) missense possibly damaging 0.87
R4583:Mical2 UTSW 7 112,012,154 (GRCm39) missense probably benign 0.02
R4868:Mical2 UTSW 7 111,917,831 (GRCm39) missense probably damaging 1.00
R4902:Mical2 UTSW 7 111,936,107 (GRCm39) missense probably benign
R5112:Mical2 UTSW 7 111,919,818 (GRCm39) missense probably damaging 1.00
R5459:Mical2 UTSW 7 111,981,444 (GRCm39) missense probably benign 0.00
R5487:Mical2 UTSW 7 111,919,842 (GRCm39) missense probably damaging 1.00
R5563:Mical2 UTSW 7 111,914,185 (GRCm39) missense probably damaging 1.00
R5763:Mical2 UTSW 7 111,973,861 (GRCm39) critical splice donor site probably null
R5817:Mical2 UTSW 7 111,922,866 (GRCm39) missense probably benign
R5987:Mical2 UTSW 7 111,934,155 (GRCm39) missense probably benign 0.00
R6042:Mical2 UTSW 7 111,979,619 (GRCm39) missense probably benign 0.40
R6087:Mical2 UTSW 7 111,917,692 (GRCm39) nonsense probably null
R6189:Mical2 UTSW 7 112,012,087 (GRCm39) missense probably damaging 1.00
R6209:Mical2 UTSW 7 111,923,293 (GRCm39) splice site probably null
R6311:Mical2 UTSW 7 111,922,765 (GRCm39) missense probably damaging 1.00
R6319:Mical2 UTSW 7 111,927,884 (GRCm39) missense possibly damaging 0.80
R6578:Mical2 UTSW 7 111,910,652 (GRCm39) missense probably damaging 1.00
R6750:Mical2 UTSW 7 111,981,046 (GRCm39) missense probably damaging 0.98
R6782:Mical2 UTSW 7 111,945,968 (GRCm39) missense probably damaging 1.00
R6798:Mical2 UTSW 7 111,975,266 (GRCm39) utr 3 prime probably benign
R7061:Mical2 UTSW 7 111,946,008 (GRCm39) missense probably benign 0.10
R7147:Mical2 UTSW 7 111,922,810 (GRCm39) missense possibly damaging 0.77
R7260:Mical2 UTSW 7 111,919,001 (GRCm39) missense probably benign 0.10
R7266:Mical2 UTSW 7 111,902,963 (GRCm39) missense probably damaging 1.00
R7347:Mical2 UTSW 7 111,981,358 (GRCm39) missense probably benign 0.01
R7391:Mical2 UTSW 7 111,919,816 (GRCm39) missense probably damaging 1.00
R7724:Mical2 UTSW 7 111,922,833 (GRCm39) missense probably damaging 1.00
R7747:Mical2 UTSW 7 111,933,046 (GRCm39) missense probably benign 0.02
R7783:Mical2 UTSW 7 112,012,183 (GRCm39) missense probably damaging 1.00
R7818:Mical2 UTSW 7 111,944,514 (GRCm39) missense probably damaging 1.00
R7824:Mical2 UTSW 7 112,006,844 (GRCm39) missense probably damaging 1.00
R7995:Mical2 UTSW 7 111,980,975 (GRCm39) missense probably benign 0.31
R8022:Mical2 UTSW 7 111,902,974 (GRCm39) missense probably damaging 1.00
R8429:Mical2 UTSW 7 111,944,460 (GRCm39) missense probably benign 0.01
R8505:Mical2 UTSW 7 111,919,007 (GRCm39) missense probably benign 0.02
R8532:Mical2 UTSW 7 111,917,751 (GRCm39) missense probably damaging 1.00
R8830:Mical2 UTSW 7 111,980,403 (GRCm39) missense probably benign 0.01
R8862:Mical2 UTSW 7 111,910,574 (GRCm39) missense probably damaging 1.00
R8906:Mical2 UTSW 7 111,980,671 (GRCm39) missense probably damaging 0.99
R8988:Mical2 UTSW 7 111,910,661 (GRCm39) missense possibly damaging 0.63
R9006:Mical2 UTSW 7 111,981,323 (GRCm39) missense probably benign 0.13
R9123:Mical2 UTSW 7 111,870,589 (GRCm39) missense possibly damaging 0.61
R9127:Mical2 UTSW 7 111,870,589 (GRCm39) missense possibly damaging 0.61
R9128:Mical2 UTSW 7 111,870,589 (GRCm39) missense possibly damaging 0.61
R9129:Mical2 UTSW 7 111,870,589 (GRCm39) missense possibly damaging 0.61
R9140:Mical2 UTSW 7 112,006,826 (GRCm39) missense probably damaging 1.00
R9187:Mical2 UTSW 7 111,902,797 (GRCm39) nonsense probably null
R9233:Mical2 UTSW 7 111,981,399 (GRCm39) missense probably benign 0.05
R9304:Mical2 UTSW 7 111,980,974 (GRCm39) missense probably damaging 0.97
R9310:Mical2 UTSW 7 111,950,920 (GRCm39) missense probably benign 0.45
R9377:Mical2 UTSW 7 111,981,246 (GRCm39) missense probably benign 0.10
R9399:Mical2 UTSW 7 111,946,082 (GRCm39) missense probably damaging 1.00
R9457:Mical2 UTSW 7 112,010,665 (GRCm39) missense probably damaging 0.96
R9500:Mical2 UTSW 7 111,936,054 (GRCm39) critical splice acceptor site probably null
R9620:Mical2 UTSW 7 111,980,403 (GRCm39) missense probably benign 0.01
R9652:Mical2 UTSW 7 111,945,996 (GRCm39) missense probably damaging 1.00
R9657:Mical2 UTSW 7 111,921,806 (GRCm39) missense probably benign 0.37
R9756:Mical2 UTSW 7 111,902,928 (GRCm39) missense probably damaging 0.99
R9789:Mical2 UTSW 7 111,945,996 (GRCm39) missense probably damaging 1.00
RF008:Mical2 UTSW 7 111,922,833 (GRCm39) missense probably damaging 1.00
X0062:Mical2 UTSW 7 111,946,050 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCCTGACATAACTCCATACC -3'
(R):5'- TCTATCAAACTGAGCCTGGATCC -3'

Sequencing Primer
(F):5'- CCATACCAGCACTTGTGTGTGG -3'
(R):5'- ATCCCAGTGGCTCATGAGAG -3'
Posted On 2015-10-08