Mutagenetix > Incidental Mutation

Incidental Mutation 'R4663:Lats1'

353023

Institutional Source

Beutler Lab

Gene Symbol

Lats1

Ensembl Gene

ENSMUSG00000040021

Gene Name

large tumor suppressor

Synonyms

MMRRC Submission

041921-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.815) question?

Stock #

R4663 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

7681214-7716460 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 7712583 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Tyrosine at position 988 (C988Y)

Ref Sequence

ENSEMBL: ENSMUSP00000151533 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000040043] [ENSMUST00000165952] [ENSMUST00000217931]

AlphaFold

Q8BYR2

Predicted Effect

probably damaging
Transcript: ENSMUST00000040043
AA Change: C988Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000041915
Gene: ENSMUSG00000040021
AA Change: C988Y

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000165952
AA Change: C988Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000132078
Gene: ENSMUSG00000040021
AA Change: C988Y

Domain	Start	End	E-Value	Type
Pfam:UBA	101	138	7.4e-11	PFAM
low complexity region	228	267	N/A	INTRINSIC
low complexity region	301	314	N/A	INTRINSIC
low complexity region	371	379	N/A	INTRINSIC
low complexity region	433	445	N/A	INTRINSIC
low complexity region	482	493	N/A	INTRINSIC
low complexity region	520	530	N/A	INTRINSIC
low complexity region	554	559	N/A	INTRINSIC
S_TKc	704	1009	7.3e-99	SMART
S_TK_X	1010	1081	1.2e-2	SMART
low complexity region	1102	1120	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000217931
AA Change: C988Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a putative serine/threonine kinase that localizes to the mitotic apparatus and complexes with cell cycle controller CDC2 kinase in early mitosis. The protein is phosphorylated in a cell-cycle dependent manner, with late prophase phosphorylation remaining through metaphase. The N-terminal region of the protein binds CDC2 to form a complex showing reduced H1 histone kinase activity, indicating a role as a negative regulator of CDC2/cyclin A. In addition, the C-terminal kinase domain binds to its own N-terminal region, suggesting potential negative regulation through interference with complex formation via intramolecular binding. Biochemical and genetic data suggest a role as a tumor suppressor. This is supported by studies in knockout mice showing development of soft-tissue sarcomas, ovarian stromal cell tumors and a high sensitivity to carcinogenic treatments. Two protein-coding transcripts and one non-protein coding transcript have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit high postnatal mortality, lack of mammary development, infertility, pituitary hyperplasia, reduced hormone levels, growth retardation, and susceptibility to sarcomas and ovarian stromal cell tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,218,455	V1496A	probably benign	Het
Aqr	A	T	2: 114,161,666	Y76*	probably null	Het
Armc5	C	A	7: 128,238,545	A140E	probably benign	Het
Auts2	T	C	5: 131,439,638	H947R	probably damaging	Het
Bag2	T	C	1: 33,746,993	T83A	probably damaging	Het
Bag4	C	T	8: 25,769,488	A228T	probably benign	Het
Bean1	A	G	8: 104,211,167	Y126C	probably damaging	Het
Cars	T	C	7: 143,575,960	E330G	probably damaging	Het
Ccdc40	A	G	11: 119,231,506	I45V	probably benign	Het
Cd320	G	A	17: 33,848,178	G214R	probably null	Het
Ckm	G	A	7: 19,419,494	V237M	probably damaging	Het
Cspg4	T	C	9: 56,886,676	V565A	possibly damaging	Het
Ephb6	A	G	6: 41,617,865	Y638C	probably damaging	Het
Epp13	T	G	7: 6,258,625	I35S	possibly damaging	Het
Fam196a	A	T	7: 134,899,148	Y409*	probably null	Het
Fat2	G	C	11: 55,296,213	S1269*	probably null	Het
Fbxo3	T	C	2: 104,053,475	V348A	probably damaging	Het
Gas6	G	A	8: 13,470,254	P478L	probably damaging	Het
Gm11492	T	A	11: 87,567,603	Y268N	probably damaging	Het
Herc1	T	C	9: 66,433,378	S1670P	probably damaging	Het
Hnrnpk	C	A	13: 58,394,517	R281L	probably damaging	Het
Ifih1	C	A	2: 62,609,219	C488F	probably benign	Het
Ift172	T	C	5: 31,284,215	K192E	probably benign	Het
Ighv5-9	T	A	12: 113,661,820	Q101L	probably benign	Het
Igkv3-2	G	T	6: 70,698,879	M57I	probably benign	Het
Itpr2	A	G	6: 146,373,173	F837S	probably damaging	Het
L3mbtl3	T	C	10: 26,337,817	Y237C	unknown	Het
Lgals3	T	A	14: 47,381,622		probably null	Het
Lrrc3b	G	T	14: 15,358,220	H129N	probably benign	Het
Lrriq1	T	C	10: 103,063,412	H1656R	possibly damaging	Het
Lypd6	T	G	2: 50,173,611	Y43*	probably null	Het
Mfsd7a	T	C	5: 108,442,145	M464V	probably benign	Het
Mical2	A	G	7: 112,328,677	D674G	possibly damaging	Het
Msi1	G	A	5: 115,450,275	R284Q	probably damaging	Het
Mybpc2	T	C	7: 44,505,642	E947G	probably damaging	Het
Nat14	T	A	7: 4,924,447	L206Q	probably damaging	Het
Nup88	A	T	11: 70,965,846		probably null	Het
Olfr27	A	T	9: 39,144,849	I250F	probably damaging	Het
Olfr727	A	G	14: 50,127,482	R302G	probably benign	Het
Olfr743	A	T	14: 50,533,604	Y64F	probably damaging	Het
Pdcl	T	C	2: 37,355,766	E75G	probably damaging	Het
Phf14	A	G	6: 11,953,422	I387V	possibly damaging	Het
Phf3	G	A	1: 30,821,215	R845W	probably damaging	Het
Pm20d1	T	C	1: 131,798,602	I59T	probably damaging	Het
Prkd1	C	T	12: 50,419,848		probably null	Het
Psmb2	T	C	4: 126,677,765	L4P	probably damaging	Het
Pttg1	T	A	11: 43,424,850	K46*	probably null	Het
Rrnad1	A	G	3: 87,927,748	S82P	probably damaging	Het
Ryr2	T	C	13: 11,749,509	H1401R	possibly damaging	Het
Sh3d19	G	A	3: 86,123,263	D696N	probably benign	Het
Slc16a2	T	C	X: 103,707,979	T274A	probably benign	Het
Slc26a6	G	A	9: 108,857,907	A335T	probably damaging	Het
Slc6a5	C	A	7: 49,938,398	Y493*	probably null	Het
Slf1	A	T	13: 77,126,604	S37R	probably damaging	Het
Smoc1	G	A	12: 81,167,602	G264S	probably damaging	Het
Snapc4	T	C	2: 26,374,181	E280G	possibly damaging	Het
Snx25	G	A	8: 46,035,579	T913M	probably damaging	Het
Snx7	T	C	3: 117,800,879	T408A	probably benign	Het
Spdya	T	A	17: 71,578,344	S264R	probably benign	Het
Spg11	A	T	2: 122,098,099		probably null	Het
Suz12	T	A	11: 80,013,524	L230Q	probably damaging	Het
Szt2	A	G	4: 118,377,684		probably benign	Het
Tenm3	C	A	8: 48,235,970	R2194L	probably damaging	Het
Tmed8	T	A	12: 87,174,231	I194F	probably damaging	Het
Tmem79	T	A	3: 88,333,444	T66S	probably damaging	Het
Trappc1	T	A	11: 69,325,511	S118T	probably benign	Het
Ttn	C	T	2: 76,738,881	V27223I	probably benign	Het
Ttn	T	C	2: 76,776,495	T18024A	probably damaging	Het
Vmn2r15	C	T	5: 109,294,074	M164I	probably benign	Het
Vmn2r53	T	A	7: 12,600,974	Y253F	probably benign	Het
Wdr92	T	C	11: 17,232,853	V338A	probably benign	Het
Zfand6	C	T	7: 84,617,885	R163H	probably benign	Het

Other mutations in Lats1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00234:Lats1	APN	10	7691566	missense	probably damaging	0.99
IGL00595:Lats1	APN	10	7702305	missense	probably benign	0.00
IGL00932:Lats1	APN	10	7712742	missense	possibly damaging	0.69
IGL01019:Lats1	APN	10	7705671	missense	probably damaging	1.00
IGL01380:Lats1	APN	10	7691780	missense	possibly damaging	0.69
IGL01965:Lats1	APN	10	7701706	missense	probably benign	0.10
IGL02027:Lats1	APN	10	7712948	missense	probably benign
IGL02611:Lats1	APN	10	7705787	missense	possibly damaging	0.91
IGL02997:Lats1	APN	10	7702254	missense	possibly damaging	0.53
IGL03107:Lats1	APN	10	7712746	missense	probably benign	0.15
I1329:Lats1	UTSW	10	7712802	missense	probably benign	0.10
PIT4378001:Lats1	UTSW	10	7705605	missense	probably damaging	1.00
R0153:Lats1	UTSW	10	7691575	missense	probably damaging	1.00
R0568:Lats1	UTSW	10	7712528	missense	possibly damaging	0.69
R0581:Lats1	UTSW	10	7702941	missense	possibly damaging	0.67
R0604:Lats1	UTSW	10	7712661	missense	probably damaging	0.96
R1681:Lats1	UTSW	10	7705914	missense	probably damaging	0.99
R1694:Lats1	UTSW	10	7701945	missense	probably benign	0.07
R1840:Lats1	UTSW	10	7710939	nonsense	probably null
R1914:Lats1	UTSW	10	7710457	splice site	probably benign
R2137:Lats1	UTSW	10	7701847	missense	possibly damaging	0.71
R2317:Lats1	UTSW	10	7691776	nonsense	probably null
R3863:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R3864:Lats1	UTSW	10	7705746	missense	probably damaging	1.00
R4597:Lats1	UTSW	10	7691746	missense	probably benign	0.00
R4657:Lats1	UTSW	10	7705684	missense	possibly damaging	0.82
R4658:Lats1	UTSW	10	7702729	missense	probably benign
R4870:Lats1	UTSW	10	7705785	missense	probably damaging	1.00
R5101:Lats1	UTSW	10	7712584	nonsense	probably null
R5134:Lats1	UTSW	10	7691811	missense	probably benign	0.34
R5150:Lats1	UTSW	10	7712651	missense	probably benign
R5546:Lats1	UTSW	10	7705754	missense	probably damaging	0.99
R5820:Lats1	UTSW	10	7705908	missense	probably damaging	1.00
R6006:Lats1	UTSW	10	7705595	missense	probably damaging	1.00
R6301:Lats1	UTSW	10	7703107	missense	probably benign	0.01
R6544:Lats1	UTSW	10	7701670	missense	possibly damaging	0.94
R6647:Lats1	UTSW	10	7697507	missense	possibly damaging	0.81
R6874:Lats1	UTSW	10	7710851	missense	probably damaging	1.00
R7328:Lats1	UTSW	10	7705547	missense	possibly damaging	0.62
R7390:Lats1	UTSW	10	7702095	nonsense	probably null
R7438:Lats1	UTSW	10	7712942	nonsense	probably null
R7457:Lats1	UTSW	10	7710891	missense	probably damaging	1.00
R7524:Lats1	UTSW	10	7701978	missense	possibly damaging	0.89
R7593:Lats1	UTSW	10	7701712	missense	probably damaging	1.00
R7736:Lats1	UTSW	10	7702364	missense	probably damaging	1.00
R7884:Lats1	UTSW	10	7697526	nonsense	probably null
R8166:Lats1	UTSW	10	7702116	missense	probably benign
R8248:Lats1	UTSW	10	7705903	missense	probably damaging	1.00
R8458:Lats1	UTSW	10	7710924	nonsense	probably null
R8477:Lats1	UTSW	10	7705515	missense	probably damaging	1.00
R8547:Lats1	UTSW	10	7712849	missense	probably damaging	1.00
R9163:Lats1	UTSW	10	7702288	missense	probably benign
R9441:Lats1	UTSW	10	7702917	missense	probably damaging	0.96
R9673:Lats1	UTSW	10	7712623	missense	probably benign	0.29
RF021:Lats1	UTSW	10	7710608	missense	probably damaging	1.00
X0026:Lats1	UTSW	10	7710623	missense	probably damaging	1.00
X0053:Lats1	UTSW	10	7691609	missense	probably benign	0.00
Z1176:Lats1	UTSW	10	7705809	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCGGCAGATCATTTAGAAAACCAAG -3'
(R):5'- CCATCCGTTCAGAGTGTCACTG -3'

Sequencing Primer
(F):5'- CCAAGTAGTCCAGGAAGACATTTG -3'
(R):5'- GCCATCGCTCCACAATTTATCAGG -3'

Posted On

2015-10-08