Incidental Mutation 'R4663:Wdr92'
ID353026
Institutional Source Beutler Lab
Gene Symbol Wdr92
Ensembl Gene ENSMUSG00000078970
Gene NameWD repeat domain 92
Synonyms
MMRRC Submission 041921-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R4663 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location17182107-17233796 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17232853 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 338 (V338A)
Ref Sequence ENSEMBL: ENSMUSP00000040938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046955]
Predicted Effect probably benign
Transcript: ENSMUST00000046955
AA Change: V338A

PolyPhen 2 Score 0.015 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000040938
Gene: ENSMUSG00000078970
AA Change: V338A

DomainStartEndE-ValueType
WD40 55 96 6.88e0 SMART
WD40 100 145 5.15e-2 SMART
Blast:WD40 149 196 8e-27 BLAST
WD40 199 240 2.54e2 SMART
WD40 246 288 2.06e0 SMART
WD40 310 350 7.7e-1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151431
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with two WD40 repeat domains thought to be involved in an apoptosis via activation of caspase-3. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,218,455 V1496A probably benign Het
Aqr A T 2: 114,161,666 Y76* probably null Het
Armc5 C A 7: 128,238,545 A140E probably benign Het
Auts2 T C 5: 131,439,638 H947R probably damaging Het
Bag2 T C 1: 33,746,993 T83A probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bean1 A G 8: 104,211,167 Y126C probably damaging Het
Cars T C 7: 143,575,960 E330G probably damaging Het
Ccdc40 A G 11: 119,231,506 I45V probably benign Het
Cd320 G A 17: 33,848,178 G214R probably null Het
Ckm G A 7: 19,419,494 V237M probably damaging Het
Cspg4 T C 9: 56,886,676 V565A possibly damaging Het
Ephb6 A G 6: 41,617,865 Y638C probably damaging Het
Epp13 T G 7: 6,258,625 I35S possibly damaging Het
Fam196a A T 7: 134,899,148 Y409* probably null Het
Fat2 G C 11: 55,296,213 S1269* probably null Het
Fbxo3 T C 2: 104,053,475 V348A probably damaging Het
Gas6 G A 8: 13,470,254 P478L probably damaging Het
Gm11492 T A 11: 87,567,603 Y268N probably damaging Het
Herc1 T C 9: 66,433,378 S1670P probably damaging Het
Hnrnpk C A 13: 58,394,517 R281L probably damaging Het
Ifih1 C A 2: 62,609,219 C488F probably benign Het
Ift172 T C 5: 31,284,215 K192E probably benign Het
Ighv5-9 T A 12: 113,661,820 Q101L probably benign Het
Igkv3-2 G T 6: 70,698,879 M57I probably benign Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
L3mbtl3 T C 10: 26,337,817 Y237C unknown Het
Lats1 G A 10: 7,712,583 C988Y probably damaging Het
Lgals3 T A 14: 47,381,622 probably null Het
Lrrc3b G T 14: 15,358,220 H129N probably benign Het
Lrriq1 T C 10: 103,063,412 H1656R possibly damaging Het
Lypd6 T G 2: 50,173,611 Y43* probably null Het
Mfsd7a T C 5: 108,442,145 M464V probably benign Het
Mical2 A G 7: 112,328,677 D674G possibly damaging Het
Msi1 G A 5: 115,450,275 R284Q probably damaging Het
Mybpc2 T C 7: 44,505,642 E947G probably damaging Het
Nat14 T A 7: 4,924,447 L206Q probably damaging Het
Nup88 A T 11: 70,965,846 probably null Het
Olfr27 A T 9: 39,144,849 I250F probably damaging Het
Olfr727 A G 14: 50,127,482 R302G probably benign Het
Olfr743 A T 14: 50,533,604 Y64F probably damaging Het
Pdcl T C 2: 37,355,766 E75G probably damaging Het
Phf14 A G 6: 11,953,422 I387V possibly damaging Het
Phf3 G A 1: 30,821,215 R845W probably damaging Het
Pm20d1 T C 1: 131,798,602 I59T probably damaging Het
Prkd1 C T 12: 50,419,848 probably null Het
Psmb2 T C 4: 126,677,765 L4P probably damaging Het
Pttg1 T A 11: 43,424,850 K46* probably null Het
Rrnad1 A G 3: 87,927,748 S82P probably damaging Het
Ryr2 T C 13: 11,749,509 H1401R possibly damaging Het
Sh3d19 G A 3: 86,123,263 D696N probably benign Het
Slc16a2 T C X: 103,707,979 T274A probably benign Het
Slc26a6 G A 9: 108,857,907 A335T probably damaging Het
Slc6a5 C A 7: 49,938,398 Y493* probably null Het
Slf1 A T 13: 77,126,604 S37R probably damaging Het
Smoc1 G A 12: 81,167,602 G264S probably damaging Het
Snapc4 T C 2: 26,374,181 E280G possibly damaging Het
Snx25 G A 8: 46,035,579 T913M probably damaging Het
Snx7 T C 3: 117,800,879 T408A probably benign Het
Spdya T A 17: 71,578,344 S264R probably benign Het
Spg11 A T 2: 122,098,099 probably null Het
Suz12 T A 11: 80,013,524 L230Q probably damaging Het
Szt2 A G 4: 118,377,684 probably benign Het
Tenm3 C A 8: 48,235,970 R2194L probably damaging Het
Tmed8 T A 12: 87,174,231 I194F probably damaging Het
Tmem79 T A 3: 88,333,444 T66S probably damaging Het
Trappc1 T A 11: 69,325,511 S118T probably benign Het
Ttn C T 2: 76,738,881 V27223I probably benign Het
Ttn T C 2: 76,776,495 T18024A probably damaging Het
Vmn2r15 C T 5: 109,294,074 M164I probably benign Het
Vmn2r53 T A 7: 12,600,974 Y253F probably benign Het
Zfand6 C T 7: 84,617,885 R163H probably benign Het
Other mutations in Wdr92
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Wdr92 APN 11 17232790 missense probably benign
IGL01801:Wdr92 APN 11 17219015 missense probably benign 0.00
IGL02573:Wdr92 APN 11 17212136 missense possibly damaging 0.92
IGL02985:Wdr92 APN 11 17229845 missense probably damaging 1.00
IGL03148:Wdr92 APN 11 17229845 missense probably damaging 1.00
IGL03147:Wdr92 UTSW 11 17229845 missense probably damaging 1.00
R0244:Wdr92 UTSW 11 17229851 missense probably damaging 1.00
R0276:Wdr92 UTSW 11 17229821 missense probably benign 0.33
R1013:Wdr92 UTSW 11 17228183 missense probably damaging 1.00
R1660:Wdr92 UTSW 11 17227183 missense probably benign 0.00
R2030:Wdr92 UTSW 11 17229832 missense probably benign
R4676:Wdr92 UTSW 11 17229794 missense probably benign 0.00
R4822:Wdr92 UTSW 11 17227165 missense probably damaging 1.00
R5328:Wdr92 UTSW 11 17222220 missense probably damaging 0.97
R5439:Wdr92 UTSW 11 17212031 missense possibly damaging 0.46
R5473:Wdr92 UTSW 11 17224591 missense probably damaging 0.99
R5642:Wdr92 UTSW 11 17227263 missense possibly damaging 0.89
R5771:Wdr92 UTSW 11 17224638 missense probably benign 0.00
R6680:Wdr92 UTSW 11 17229857 missense probably damaging 1.00
R6889:Wdr92 UTSW 11 17222309 missense probably damaging 1.00
R7367:Wdr92 UTSW 11 17232712 missense probably damaging 1.00
R7693:Wdr92 UTSW 11 17212064 missense probably benign 0.25
R7785:Wdr92 UTSW 11 17229785 missense probably damaging 1.00
Z1176:Wdr92 UTSW 11 17228184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACGCCAAGCTTTCACTCTTAC -3'
(R):5'- AAGATGCTAGAGGCTGGCTG -3'

Sequencing Primer
(F):5'- AAGCTTTCACTCTTACCCCTTTG -3'
(R):5'- CATGGCTGTCACTCATCACTCAAATC -3'
Posted On2015-10-08