Incidental Mutation 'R4663:Or4k15'
ID 353044
Institutional Source Beutler Lab
Gene Symbol Or4k15
Ensembl Gene ENSMUSG00000059488
Gene Name olfactory receptor family 4 subfamily K member 15
Synonyms Olfr727, GA_x6K02T2PMLR-5817082-5818056, MOR246-2
MMRRC Submission 041921-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.140) question?
Stock # R4663 (G1)
Quality Score 225
Status Not validated
Chromosome 14
Chromosomal Location 50364010-50365044 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 50364939 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glycine at position 302 (R302G)
Ref Sequence ENSEMBL: ENSMUSP00000149886 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079142] [ENSMUST00000215317]
AlphaFold A2RTN7
Predicted Effect probably benign
Transcript: ENSMUST00000079142
AA Change: R302G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000078145
Gene: ENSMUSG00000059488
AA Change: R302G

DomainStartEndE-ValueType
Pfam:7tm_4 31 304 8.5e-49 PFAM
Pfam:7TM_GPCR_Srsx 36 290 1.5e-7 PFAM
Pfam:7tm_1 41 287 1.1e-22 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205947
Predicted Effect probably benign
Transcript: ENSMUST00000215317
AA Change: R302G

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aqr A T 2: 113,992,147 (GRCm39) Y76* probably null Het
Armc5 C A 7: 127,837,717 (GRCm39) A140E probably benign Het
Auts2 T C 5: 131,468,476 (GRCm39) H947R probably damaging Het
Bag2 T C 1: 33,786,074 (GRCm39) T83A probably damaging Het
Bag4 C T 8: 26,259,516 (GRCm39) A228T probably benign Het
Bean1 A G 8: 104,937,799 (GRCm39) Y126C probably damaging Het
Cars1 T C 7: 143,129,697 (GRCm39) E330G probably damaging Het
Ccdc40 A G 11: 119,122,332 (GRCm39) I45V probably benign Het
Cd320 G A 17: 34,067,152 (GRCm39) G214R probably null Het
Ckm G A 7: 19,153,419 (GRCm39) V237M probably damaging Het
Cplane1 T C 15: 8,247,939 (GRCm39) V1496A probably benign Het
Cspg4 T C 9: 56,793,960 (GRCm39) V565A possibly damaging Het
Dnaaf10 T C 11: 17,182,853 (GRCm39) V338A probably benign Het
Eddm13 T G 7: 6,261,624 (GRCm39) I35S possibly damaging Het
Ephb6 A G 6: 41,594,799 (GRCm39) Y638C probably damaging Het
Fat2 G C 11: 55,187,039 (GRCm39) S1269* probably null Het
Fbxo3 T C 2: 103,883,820 (GRCm39) V348A probably damaging Het
Gas6 G A 8: 13,520,254 (GRCm39) P478L probably damaging Het
Herc1 T C 9: 66,340,660 (GRCm39) S1670P probably damaging Het
Hnrnpk C A 13: 58,542,331 (GRCm39) R281L probably damaging Het
Ifih1 C A 2: 62,439,563 (GRCm39) C488F probably benign Het
Ift172 T C 5: 31,441,559 (GRCm39) K192E probably benign Het
Ighv5-9 T A 12: 113,625,440 (GRCm39) Q101L probably benign Het
Igkv3-2 G T 6: 70,675,863 (GRCm39) M57I probably benign Het
Insyn2a A T 7: 134,500,877 (GRCm39) Y409* probably null Het
Itpr2 A G 6: 146,274,671 (GRCm39) F837S probably damaging Het
L3mbtl3 T C 10: 26,213,715 (GRCm39) Y237C unknown Het
Lats1 G A 10: 7,588,347 (GRCm39) C988Y probably damaging Het
Lgals3 T A 14: 47,619,079 (GRCm39) probably null Het
Lrrc3b G T 14: 15,358,220 (GRCm38) H129N probably benign Het
Lrriq1 T C 10: 102,899,273 (GRCm39) H1656R possibly damaging Het
Lypd6 T G 2: 50,063,623 (GRCm39) Y43* probably null Het
Mettl25b A G 3: 87,835,055 (GRCm39) S82P probably damaging Het
Mical2 A G 7: 111,927,884 (GRCm39) D674G possibly damaging Het
Msi1 G A 5: 115,588,334 (GRCm39) R284Q probably damaging Het
Mybpc2 T C 7: 44,155,066 (GRCm39) E947G probably damaging Het
Nat14 T A 7: 4,927,446 (GRCm39) L206Q probably damaging Het
Nup88 A T 11: 70,856,672 (GRCm39) probably null Het
Or11g27 A T 14: 50,771,061 (GRCm39) Y64F probably damaging Het
Or8g19 A T 9: 39,056,145 (GRCm39) I250F probably damaging Het
Pdcl T C 2: 37,245,778 (GRCm39) E75G probably damaging Het
Phf14 A G 6: 11,953,421 (GRCm39) I387V possibly damaging Het
Phf3 G A 1: 30,860,296 (GRCm39) R845W probably damaging Het
Pm20d1 T C 1: 131,726,340 (GRCm39) I59T probably damaging Het
Prkd1 C T 12: 50,466,631 (GRCm39) probably null Het
Psmb2 T C 4: 126,571,558 (GRCm39) L4P probably damaging Het
Pttg1 T A 11: 43,315,677 (GRCm39) K46* probably null Het
Ryr2 T C 13: 11,764,395 (GRCm39) H1401R possibly damaging Het
Septin4 T A 11: 87,458,429 (GRCm39) Y268N probably damaging Het
Sh3d19 G A 3: 86,030,570 (GRCm39) D696N probably benign Het
Slc16a2 T C X: 102,751,585 (GRCm39) T274A probably benign Het
Slc26a6 G A 9: 108,735,106 (GRCm39) A335T probably damaging Het
Slc49a3 T C 5: 108,590,011 (GRCm39) M464V probably benign Het
Slc6a5 C A 7: 49,588,146 (GRCm39) Y493* probably null Het
Slf1 A T 13: 77,274,723 (GRCm39) S37R probably damaging Het
Smoc1 G A 12: 81,214,376 (GRCm39) G264S probably damaging Het
Snapc4 T C 2: 26,264,193 (GRCm39) E280G possibly damaging Het
Snx25 G A 8: 46,488,616 (GRCm39) T913M probably damaging Het
Snx7 T C 3: 117,594,528 (GRCm39) T408A probably benign Het
Spdya T A 17: 71,885,339 (GRCm39) S264R probably benign Het
Spg11 A T 2: 121,928,580 (GRCm39) probably null Het
Suz12 T A 11: 79,904,350 (GRCm39) L230Q probably damaging Het
Szt2 A G 4: 118,234,881 (GRCm39) probably benign Het
Tenm3 C A 8: 48,689,005 (GRCm39) R2194L probably damaging Het
Tmed8 T A 12: 87,221,005 (GRCm39) I194F probably damaging Het
Tmem79 T A 3: 88,240,751 (GRCm39) T66S probably damaging Het
Trappc1 T A 11: 69,216,337 (GRCm39) S118T probably benign Het
Ttn C T 2: 76,569,225 (GRCm39) V27223I probably benign Het
Ttn T C 2: 76,606,839 (GRCm39) T18024A probably damaging Het
Vmn2r15 C T 5: 109,441,940 (GRCm39) M164I probably benign Het
Vmn2r53 T A 7: 12,334,901 (GRCm39) Y253F probably benign Het
Zfand6 C T 7: 84,267,093 (GRCm39) R163H probably benign Het
Other mutations in Or4k15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Or4k15 APN 14 50,364,214 (GRCm39) missense probably damaging 1.00
IGL01306:Or4k15 APN 14 50,364,039 (GRCm39) missense probably benign 0.00
ANU23:Or4k15 UTSW 14 50,364,039 (GRCm39) missense probably benign 0.00
R0498:Or4k15 UTSW 14 50,364,750 (GRCm39) missense probably damaging 1.00
R0574:Or4k15 UTSW 14 50,364,139 (GRCm39) missense probably damaging 1.00
R1201:Or4k15 UTSW 14 50,364,813 (GRCm39) missense probably damaging 1.00
R2112:Or4k15 UTSW 14 50,364,080 (GRCm39) missense probably damaging 1.00
R2435:Or4k15 UTSW 14 50,364,211 (GRCm39) missense probably damaging 1.00
R4238:Or4k15 UTSW 14 50,364,889 (GRCm39) missense probably benign
R4611:Or4k15 UTSW 14 50,364,530 (GRCm39) missense probably benign 0.12
R4672:Or4k15 UTSW 14 50,364,714 (GRCm39) missense probably benign 0.02
R5022:Or4k15 UTSW 14 50,364,469 (GRCm39) missense possibly damaging 0.78
R5062:Or4k15 UTSW 14 50,364,894 (GRCm39) missense probably damaging 1.00
R5924:Or4k15 UTSW 14 50,364,139 (GRCm39) missense probably damaging 1.00
R6702:Or4k15 UTSW 14 50,364,688 (GRCm39) missense probably damaging 1.00
R6703:Or4k15 UTSW 14 50,364,688 (GRCm39) missense probably damaging 1.00
R7497:Or4k15 UTSW 14 50,364,952 (GRCm39) missense probably benign 0.20
R7615:Or4k15 UTSW 14 50,364,446 (GRCm39) missense probably benign 0.07
R7798:Or4k15 UTSW 14 50,364,895 (GRCm39) missense probably damaging 1.00
R8413:Or4k15 UTSW 14 50,364,827 (GRCm39) missense probably benign 0.19
R8439:Or4k15 UTSW 14 50,364,604 (GRCm39) missense probably benign
R8841:Or4k15 UTSW 14 50,364,666 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCGTTCCTCTGCTAGCATG -3'
(R):5'- GTAGTAAGCCTTTAAACAGCCCC -3'

Sequencing Primer
(F):5'- TCTGCTAGCATGGCCAAG -3'
(R):5'- ACAGCCCCACATATTAAATAACTAAC -3'
Posted On 2015-10-08