Incidental Mutation 'R4664:Cdc42bpa'
ID353056
Institutional Source Beutler Lab
Gene Symbol Cdc42bpa
Ensembl Gene ENSMUSG00000026490
Gene NameCDC42 binding protein kinase alpha
SynonymsA930014J19Rik, DMPK-like
MMRRC Submission 041922-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.565) question?
Stock #R4664 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location179960472-180165603 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 180144565 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 527 (T527A)
Ref Sequence ENSEMBL: ENSMUSP00000114333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076687] [ENSMUST00000097450] [ENSMUST00000097453] [ENSMUST00000111117] [ENSMUST00000135056] [ENSMUST00000212756]
Predicted Effect possibly damaging
Transcript: ENSMUST00000076687
AA Change: T1217A

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000075980
Gene: ENSMUSG00000026490
AA Change: T1217A

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
coiled coil region 435 588 N/A INTRINSIC
coiled coil region 632 735 N/A INTRINSIC
Pfam:DMPK_coil 800 860 2.7e-29 PFAM
C1 919 968 4.09e-7 SMART
PH 989 1109 6.02e-8 SMART
CNH 1134 1411 3.37e-17 SMART
low complexity region 1456 1468 N/A INTRINSIC
PBD 1477 1512 2.05e-10 SMART
low complexity region 1531 1546 N/A INTRINSIC
low complexity region 1567 1580 N/A INTRINSIC
low complexity region 1606 1620 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097450
AA Change: T1298A

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000095059
Gene: ENSMUSG00000026490
AA Change: T1298A

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
coiled coil region 435 669 N/A INTRINSIC
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.2e-29 PFAM
C1 1000 1049 4.09e-7 SMART
PH 1070 1190 6.02e-8 SMART
CNH 1215 1492 3.37e-17 SMART
low complexity region 1537 1549 N/A INTRINSIC
PBD 1558 1593 2.05e-10 SMART
low complexity region 1612 1627 N/A INTRINSIC
low complexity region 1648 1661 N/A INTRINSIC
low complexity region 1687 1701 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000097453
AA Change: T1270A

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000095062
Gene: ENSMUSG00000026490
AA Change: T1270A

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
coiled coil region 435 669 N/A INTRINSIC
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.5e-29 PFAM
C1 972 1021 4.09e-7 SMART
PH 1042 1162 6.02e-8 SMART
CNH 1187 1464 3.37e-17 SMART
low complexity region 1509 1521 N/A INTRINSIC
PBD 1530 1565 2.05e-10 SMART
low complexity region 1584 1599 N/A INTRINSIC
low complexity region 1620 1633 N/A INTRINSIC
low complexity region 1659 1673 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111117
AA Change: T1311A

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106746
Gene: ENSMUSG00000026490
AA Change: T1311A

DomainStartEndE-ValueType
S_TKc 77 343 1.06e-86 SMART
S_TK_X 344 406 1.18e-15 SMART
low complexity region 484 499 N/A INTRINSIC
Pfam:KELK 529 608 1.1e-32 PFAM
coiled coil region 713 816 N/A INTRINSIC
Pfam:DMPK_coil 881 941 2.6e-29 PFAM
C1 1013 1062 4.09e-7 SMART
PH 1083 1203 6.02e-8 SMART
CNH 1228 1505 3.37e-17 SMART
low complexity region 1550 1562 N/A INTRINSIC
PBD 1571 1606 2.05e-10 SMART
low complexity region 1625 1640 N/A INTRINSIC
low complexity region 1661 1674 N/A INTRINSIC
low complexity region 1700 1714 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000133890
AA Change: T626A
SMART Domains Protein: ENSMUSP00000116337
Gene: ENSMUSG00000026490
AA Change: T626A

DomainStartEndE-ValueType
coiled coil region 6 109 N/A INTRINSIC
Pfam:DMPK_coil 175 235 1.4e-29 PFAM
C1 329 378 4.09e-7 SMART
PH 399 519 6.02e-8 SMART
CNH 544 821 3.37e-17 SMART
low complexity region 866 878 N/A INTRINSIC
PBD 887 922 2.05e-10 SMART
low complexity region 941 956 N/A INTRINSIC
low complexity region 977 990 N/A INTRINSIC
low complexity region 1016 1030 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000135056
AA Change: T527A

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114333
Gene: ENSMUSG00000026490
AA Change: T527A

DomainStartEndE-ValueType
Pfam:DMPK_coil 59 119 9e-30 PFAM
low complexity region 148 156 N/A INTRINSIC
C1 229 278 4.09e-7 SMART
PH 299 419 6.02e-8 SMART
CNH 444 721 3.37e-17 SMART
Predicted Effect unknown
Transcript: ENSMUST00000143176
AA Change: T500A
SMART Domains Protein: ENSMUSP00000115261
Gene: ENSMUSG00000026490
AA Change: T500A

DomainStartEndE-ValueType
Pfam:DMPK_coil 84 144 1.3e-29 PFAM
C1 203 252 4.09e-7 SMART
PH 273 393 6.02e-8 SMART
CNH 418 695 3.37e-17 SMART
low complexity region 740 752 N/A INTRINSIC
PBD 761 796 1.02e-5 SMART
PBD 802 839 2.21e-1 SMART
low complexity region 877 892 N/A INTRINSIC
low complexity region 913 926 N/A INTRINSIC
low complexity region 952 966 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195719
Predicted Effect possibly damaging
Transcript: ENSMUST00000212756
AA Change: T1327A

PolyPhen 2 Score 0.690 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.1969 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (110/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Serine/Threonine protein kinase family. This kinase contains multiple functional domains. Its kinase domain is highly similar to that of the myotonic dystrophy protein kinase (DMPK). This kinase also contains a Rac interactive binding (CRIB) domain, and has been shown to bind CDC42. It may function as a CDC42 downstream effector mediating CDC42 induced peripheral actin formation, and promoting cytoskeletal reorganization. Multiple alternatively spliced transcript variants have been described, and the full-length nature of two of them has been reported. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 A G 6: 125,863,538 I391V probably benign Het
Apc T A 18: 34,298,594 L349M probably damaging Het
Atmin A G 8: 116,957,959 D786G probably damaging Het
Atp8a1 T A 5: 67,762,586 D379V possibly damaging Het
Aurkb A G 11: 69,048,609 K173E probably damaging Het
Bak1 T C 17: 27,022,536 I83V possibly damaging Het
Btbd17 A C 11: 114,794,006 V69G probably damaging Het
Cacna1a T A 8: 84,601,767 Y1597* probably null Het
Camk2a C A 18: 60,955,624 Q167K possibly damaging Het
Capn1 A T 19: 6,011,015 N253K probably benign Het
Ccer2 A G 7: 28,756,503 E40G probably benign Het
Cdkl2 T C 5: 92,037,265 D89G probably damaging Het
Cep128 G T 12: 91,296,253 R291S probably damaging Het
Chd4 A G 6: 125,101,502 M203V possibly damaging Het
Chrna4 A G 2: 181,037,493 S54P probably damaging Het
Cic TGTTGCCCTC T 7: 25,290,674 probably benign Het
Cntn5 T A 9: 10,144,209 I152L possibly damaging Het
Cntn6 A G 6: 104,728,284 E154G probably benign Het
Col16a1 A C 4: 130,062,090 probably benign Het
Col4a3bp T C 13: 96,599,457 V175A probably benign Het
Cpvl C T 6: 53,931,933 E282K probably benign Het
Cyth2 T C 7: 45,810,719 D183G probably damaging Het
Ddx47 A T 6: 135,012,356 T48S possibly damaging Het
Dgkk A G X: 6,928,512 D685G probably benign Het
Dis3l C T 9: 64,330,798 S29N unknown Het
Dlg5 T C 14: 24,137,181 H1834R possibly damaging Het
Dnah10 T C 5: 124,828,472 M4060T possibly damaging Het
Dock3 T A 9: 106,993,544 N557I possibly damaging Het
Eprs A T 1: 185,373,076 probably benign Het
Faim2 C A 15: 99,524,700 probably null Het
Faim2 T G 15: 99,524,701 S72R probably benign Het
Fam84b A T 15: 60,823,629 D89E probably benign Het
Fanca T C 8: 123,268,972 T1364A probably damaging Het
Fance T C 17: 28,315,662 probably benign Het
Farsb A T 1: 78,443,765 H496Q possibly damaging Het
Fryl C T 5: 73,090,679 E1032K possibly damaging Het
Galnt14 A T 17: 73,507,813 probably benign Het
Gba2 A T 4: 43,568,619 probably benign Het
Gjb4 C A 4: 127,351,778 K123N probably damaging Het
Gmcl1 G A 6: 86,732,998 T56I probably benign Het
Gtf2ird1 T A 5: 134,383,902 E55V probably damaging Het
Gtpbp2 T C 17: 46,161,154 V5A probably benign Het
Hnrnpr A G 4: 136,317,175 probably null Het
Homer3 G A 8: 70,290,143 probably null Het
Hsd3b3 T C 3: 98,742,216 S264G probably damaging Het
Ints8 T C 4: 11,227,152 M574V probably benign Het
Kif4-ps G A 12: 101,149,218 noncoding transcript Het
Klhl14 A T 18: 21,554,708 N552K probably benign Het
Klhl40 A G 9: 121,780,733 E528G probably damaging Het
Lactb2 T C 1: 13,647,400 E133G probably damaging Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mab21l2 T A 3: 86,547,504 Y63F probably benign Het
Mbd1 T A 18: 74,269,526 I33N possibly damaging Het
Mertk G A 2: 128,801,212 V844M probably benign Het
Mgea5 T C 19: 45,771,945 E258G probably benign Het
Myh11 T C 16: 14,226,584 T652A possibly damaging Het
Nlrp4a C A 7: 26,449,518 Y183* probably null Het
Noa1 T A 5: 77,299,753 T558S probably benign Het
Nol11 A T 11: 107,181,000 S256T possibly damaging Het
Nr1d1 G T 11: 98,771,260 R183S possibly damaging Het
Nrg2 G T 18: 36,052,895 Q264K possibly damaging Het
Nsd3 T A 8: 25,698,866 F1027I probably damaging Het
Ntrk3 T A 7: 78,461,099 I285F probably damaging Het
Obox8 T C 7: 14,332,846 N91S possibly damaging Het
Orc5 C T 5: 22,546,522 S63N probably benign Het
Osbpl6 C T 2: 76,568,208 T412I probably benign Het
P2ry14 C T 3: 59,115,142 C308Y probably damaging Het
Pacsin1 T C 17: 27,707,064 F127L probably damaging Het
Pex11b T C 3: 96,643,835 L198P possibly damaging Het
Pla2g4e A T 2: 120,171,188 V660E probably damaging Het
Plxna4 C A 6: 32,516,950 V244F possibly damaging Het
Polr3b A G 10: 84,714,369 Y981C probably damaging Het
Popdc2 T A 16: 38,374,287 S357T probably damaging Het
Prr29 A G 11: 106,376,333 H58R probably damaging Het
Pyy T A 11: 102,107,352 M1L possibly damaging Het
Rasd2 T C 8: 75,221,928 S161P possibly damaging Het
Ryr3 C T 2: 112,996,555 probably benign Het
Sectm1a G A 11: 121,069,726 R88C possibly damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Siglecf A T 7: 43,356,413 I465F possibly damaging Het
Sorl1 A T 9: 42,004,051 M1294K probably damaging Het
Spam1 A T 6: 24,796,662 H204L probably benign Het
Sspo A T 6: 48,473,534 N2586Y possibly damaging Het
Tbc1d4 A G 14: 101,462,827 probably benign Het
Tceanc2 A T 4: 107,165,560 S77T probably damaging Het
Tedc2 A G 17: 24,220,140 probably benign Het
Tgm6 A G 2: 130,137,394 D148G probably benign Het
Tgm6 A T 2: 130,141,208 Q239L probably benign Het
Thsd7a T A 6: 12,337,314 T1235S possibly damaging Het
Thsd7a T A 6: 12,504,013 I381F possibly damaging Het
Tmc4 T C 7: 3,671,271 probably null Het
Tmem54 A T 4: 129,110,911 E186D possibly damaging Het
Tpk1 A T 6: 43,611,335 F32I probably benign Het
Trpc4ap A G 2: 155,672,997 I97T probably benign Het
Txlnb A G 10: 17,843,194 E591G probably damaging Het
Tyk2 C T 9: 21,114,207 A741T probably damaging Het
Ubr4 G A 4: 139,406,518 E742K possibly damaging Het
Uckl1 A T 2: 181,574,868 S95T possibly damaging Het
Uevld T A 7: 46,937,986 D322V probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn1r238 G T 18: 3,123,300 T38K probably damaging Het
Vps8 T A 16: 21,444,188 probably null Het
Wdr60 T C 12: 116,256,211 E37G probably damaging Het
Wdr83 T C 8: 85,080,051 probably benign Het
Zcchc6 G A 13: 59,800,599 T636I possibly damaging Het
Zfp619 A G 7: 39,534,135 T51A probably benign Het
Other mutations in Cdc42bpa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Cdc42bpa APN 1 180106121 missense probably damaging 1.00
IGL00807:Cdc42bpa APN 1 180141453 missense possibly damaging 0.88
IGL00972:Cdc42bpa APN 1 180074684 missense probably benign 0.00
IGL01084:Cdc42bpa APN 1 180142274 splice site probably benign
IGL01149:Cdc42bpa APN 1 180074572 missense probably damaging 0.99
IGL01377:Cdc42bpa APN 1 180065143 missense probably damaging 1.00
IGL01541:Cdc42bpa APN 1 180151158 critical splice acceptor site probably null
IGL01657:Cdc42bpa APN 1 180111866 missense probably benign 0.05
IGL01720:Cdc42bpa APN 1 180111282 missense probably damaging 1.00
IGL02227:Cdc42bpa APN 1 180094424 missense possibly damaging 0.64
IGL02234:Cdc42bpa APN 1 180151191 nonsense probably null
IGL02253:Cdc42bpa APN 1 180031596 splice site probably benign
IGL02587:Cdc42bpa APN 1 180093945 missense possibly damaging 0.91
IGL02671:Cdc42bpa APN 1 180061822 missense probably benign
IGL02746:Cdc42bpa APN 1 180111747 missense possibly damaging 0.91
IGL02756:Cdc42bpa APN 1 180109259 missense possibly damaging 0.77
IGL02994:Cdc42bpa APN 1 179999437 missense probably damaging 1.00
IGL03073:Cdc42bpa APN 1 180094376 splice site probably benign
IGL03295:Cdc42bpa APN 1 180150204 missense probably benign 0.00
P0022:Cdc42bpa UTSW 1 179961276 missense probably damaging 0.99
PIT4142001:Cdc42bpa UTSW 1 180031560 missense probably damaging 1.00
R0125:Cdc42bpa UTSW 1 179961198 missense probably damaging 1.00
R0268:Cdc42bpa UTSW 1 180155782 intron probably benign
R0472:Cdc42bpa UTSW 1 180040179 missense probably damaging 1.00
R0492:Cdc42bpa UTSW 1 180101190 missense probably benign 0.00
R0609:Cdc42bpa UTSW 1 180040179 missense probably damaging 1.00
R0691:Cdc42bpa UTSW 1 180144835 missense possibly damaging 0.91
R0738:Cdc42bpa UTSW 1 179999462 splice site probably benign
R1547:Cdc42bpa UTSW 1 180074644 missense probably damaging 0.99
R1553:Cdc42bpa UTSW 1 180093975 missense probably benign 0.01
R1601:Cdc42bpa UTSW 1 180065001 nonsense probably null
R1709:Cdc42bpa UTSW 1 180067224 missense probably damaging 1.00
R2101:Cdc42bpa UTSW 1 180146968 missense probably benign 0.39
R2279:Cdc42bpa UTSW 1 180036919 missense probably damaging 0.99
R2357:Cdc42bpa UTSW 1 180067227 missense possibly damaging 0.81
R2373:Cdc42bpa UTSW 1 180111784 missense possibly damaging 0.78
R2570:Cdc42bpa UTSW 1 180150177 missense possibly damaging 0.84
R3709:Cdc42bpa UTSW 1 180065063 missense probably damaging 1.00
R3710:Cdc42bpa UTSW 1 180065063 missense probably damaging 1.00
R3816:Cdc42bpa UTSW 1 180144886 missense possibly damaging 0.80
R3854:Cdc42bpa UTSW 1 180155978 intron probably benign
R3855:Cdc42bpa UTSW 1 180155978 intron probably benign
R3917:Cdc42bpa UTSW 1 180106154 critical splice donor site probably null
R4604:Cdc42bpa UTSW 1 180109194 missense probably benign 0.00
R4622:Cdc42bpa UTSW 1 180074658 missense probably damaging 0.98
R4665:Cdc42bpa UTSW 1 180144565 missense probably damaging 0.99
R4887:Cdc42bpa UTSW 1 180144635 missense possibly damaging 0.61
R4989:Cdc42bpa UTSW 1 180137801 missense probably damaging 0.99
R5033:Cdc42bpa UTSW 1 180065015 missense probably damaging 1.00
R5050:Cdc42bpa UTSW 1 180072453 nonsense probably null
R5077:Cdc42bpa UTSW 1 180094533 intron probably benign
R5196:Cdc42bpa UTSW 1 180072413 missense probably benign 0.09
R5276:Cdc42bpa UTSW 1 180137850 missense probably damaging 1.00
R5313:Cdc42bpa UTSW 1 180084433 missense probably benign
R5364:Cdc42bpa UTSW 1 180067182 missense probably benign 0.06
R5372:Cdc42bpa UTSW 1 180064979 missense probably damaging 1.00
R5405:Cdc42bpa UTSW 1 180067329 missense probably damaging 1.00
R5405:Cdc42bpa UTSW 1 180138520 missense possibly damaging 0.95
R5646:Cdc42bpa UTSW 1 180106094 missense probably damaging 0.99
R5713:Cdc42bpa UTSW 1 180084410 missense probably benign 0.03
R6012:Cdc42bpa UTSW 1 180065090 missense probably damaging 1.00
R6029:Cdc42bpa UTSW 1 180111787 missense probably damaging 1.00
R6378:Cdc42bpa UTSW 1 180093996 missense possibly damaging 0.91
R6609:Cdc42bpa UTSW 1 180101274 critical splice donor site probably null
R7122:Cdc42bpa UTSW 1 180065018 missense probably damaging 1.00
R7289:Cdc42bpa UTSW 1 180061797 nonsense probably null
R7670:Cdc42bpa UTSW 1 180065081 missense probably damaging 1.00
R7912:Cdc42bpa UTSW 1 180094013 missense probably damaging 1.00
R7993:Cdc42bpa UTSW 1 180094013 missense probably damaging 1.00
X0026:Cdc42bpa UTSW 1 179961198 missense probably damaging 1.00
Z1176:Cdc42bpa UTSW 1 180065093 missense not run
Predicted Primers PCR Primer
(F):5'- GCCTCTTCCTTCATGTAGAGATTG -3'
(R):5'- GCATATTGCATGGACCTCCTTC -3'

Sequencing Primer
(F):5'- CTTCCTTCATGTAGAGATTGTTAGAG -3'
(R):5'- GATGCTCACTGAAGATGGCCATC -3'
Posted On2015-10-08