Incidental Mutation 'R4664:Mertk'
ID353061
Institutional Source Beutler Lab
Gene Symbol Mertk
Ensembl Gene ENSMUSG00000014361
Gene Namec-mer proto-oncogene tyrosine kinase
SynonymsNyk, nmf12, Tyro 12, Eyk, Mer
MMRRC Submission 041922-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R4664 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location128698956-128802894 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 128801212 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 844 (V844M)
Ref Sequence ENSEMBL: ENSMUSP00000014505 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014505]
Predicted Effect probably benign
Transcript: ENSMUST00000014505
AA Change: V844M

PolyPhen 2 Score 0.241 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: V844M

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 94 189 8.99e-6 SMART
IG 198 276 1.54e-4 SMART
FN3 279 363 7.23e-8 SMART
FN3 379 465 6.16e-2 SMART
transmembrane domain 498 520 N/A INTRINSIC
TyrKc 582 849 2.88e-129 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140221
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (110/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 A G 6: 125,863,538 I391V probably benign Het
Apc T A 18: 34,298,594 L349M probably damaging Het
Atmin A G 8: 116,957,959 D786G probably damaging Het
Atp8a1 T A 5: 67,762,586 D379V possibly damaging Het
Aurkb A G 11: 69,048,609 K173E probably damaging Het
Bak1 T C 17: 27,022,536 I83V possibly damaging Het
Btbd17 A C 11: 114,794,006 V69G probably damaging Het
Cacna1a T A 8: 84,601,767 Y1597* probably null Het
Camk2a C A 18: 60,955,624 Q167K possibly damaging Het
Capn1 A T 19: 6,011,015 N253K probably benign Het
Ccer2 A G 7: 28,756,503 E40G probably benign Het
Cdc42bpa A G 1: 180,144,565 T527A probably damaging Het
Cdkl2 T C 5: 92,037,265 D89G probably damaging Het
Cep128 G T 12: 91,296,253 R291S probably damaging Het
Chd4 A G 6: 125,101,502 M203V possibly damaging Het
Chrna4 A G 2: 181,037,493 S54P probably damaging Het
Cic TGTTGCCCTC T 7: 25,290,674 probably benign Het
Cntn5 T A 9: 10,144,209 I152L possibly damaging Het
Cntn6 A G 6: 104,728,284 E154G probably benign Het
Col16a1 A C 4: 130,062,090 probably benign Het
Col4a3bp T C 13: 96,599,457 V175A probably benign Het
Cpvl C T 6: 53,931,933 E282K probably benign Het
Cyth2 T C 7: 45,810,719 D183G probably damaging Het
Ddx47 A T 6: 135,012,356 T48S possibly damaging Het
Dgkk A G X: 6,928,512 D685G probably benign Het
Dis3l C T 9: 64,330,798 S29N unknown Het
Dlg5 T C 14: 24,137,181 H1834R possibly damaging Het
Dnah10 T C 5: 124,828,472 M4060T possibly damaging Het
Dock3 T A 9: 106,993,544 N557I possibly damaging Het
Eprs A T 1: 185,373,076 probably benign Het
Faim2 C A 15: 99,524,700 probably null Het
Faim2 T G 15: 99,524,701 S72R probably benign Het
Fam84b A T 15: 60,823,629 D89E probably benign Het
Fanca T C 8: 123,268,972 T1364A probably damaging Het
Fance T C 17: 28,315,662 probably benign Het
Farsb A T 1: 78,443,765 H496Q possibly damaging Het
Fryl C T 5: 73,090,679 E1032K possibly damaging Het
Galnt14 A T 17: 73,507,813 probably benign Het
Gba2 A T 4: 43,568,619 probably benign Het
Gjb4 C A 4: 127,351,778 K123N probably damaging Het
Gmcl1 G A 6: 86,732,998 T56I probably benign Het
Gtf2ird1 T A 5: 134,383,902 E55V probably damaging Het
Gtpbp2 T C 17: 46,161,154 V5A probably benign Het
Hnrnpr A G 4: 136,317,175 probably benign Het
Homer3 G A 8: 70,290,143 probably null Het
Hsd3b3 T C 3: 98,742,216 S264G probably damaging Het
Ints8 T C 4: 11,227,152 M574V probably benign Het
Kif4-ps G A 12: 101,149,218 noncoding transcript Het
Klhl14 A T 18: 21,554,708 N552K probably benign Het
Klhl40 A G 9: 121,780,733 E528G probably damaging Het
Lactb2 T C 1: 13,647,400 E133G probably damaging Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mab21l2 T A 3: 86,547,504 Y63F probably benign Het
Mbd1 T A 18: 74,269,526 I33N possibly damaging Het
Mgea5 T C 19: 45,771,945 E258G probably benign Het
Myh11 T C 16: 14,226,584 T652A possibly damaging Het
Nlrp4a C A 7: 26,449,518 Y183* probably null Het
Noa1 T A 5: 77,299,753 T558S probably benign Het
Nol11 A T 11: 107,181,000 S256T possibly damaging Het
Nr1d1 G T 11: 98,771,260 R183S possibly damaging Het
Nrg2 G T 18: 36,052,895 Q264K possibly damaging Het
Nsd3 T A 8: 25,698,866 F1027I probably damaging Het
Ntrk3 T A 7: 78,461,099 I285F probably damaging Het
Obox8 T C 7: 14,332,846 N91S possibly damaging Het
Orc5 C T 5: 22,546,522 S63N probably benign Het
Osbpl6 C T 2: 76,568,208 T412I probably benign Het
P2ry14 C T 3: 59,115,142 C308Y probably damaging Het
Pacsin1 T C 17: 27,707,064 F127L probably damaging Het
Pex11b T C 3: 96,643,835 L198P possibly damaging Het
Pla2g4e A T 2: 120,171,188 V660E probably damaging Het
Plxna4 C A 6: 32,516,950 V244F possibly damaging Het
Polr3b A G 10: 84,714,369 Y981C probably damaging Het
Popdc2 T A 16: 38,374,287 S357T probably damaging Het
Prr29 A G 11: 106,376,333 H58R probably damaging Het
Pyy T A 11: 102,107,352 M1L possibly damaging Het
Rasd2 T C 8: 75,221,928 S161P possibly damaging Het
Ryr3 C T 2: 112,996,555 probably benign Het
Sectm1a G A 11: 121,069,726 R88C possibly damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Siglecf A T 7: 43,356,413 I465F possibly damaging Het
Sorl1 A T 9: 42,004,051 M1294K probably damaging Het
Spam1 A T 6: 24,796,662 H204L probably benign Het
Sspo A T 6: 48,473,534 N2586Y possibly damaging Het
Tbc1d4 A G 14: 101,462,827 probably benign Het
Tceanc2 A T 4: 107,165,560 S77T probably damaging Het
Tedc2 A G 17: 24,220,140 probably benign Het
Tgm6 A G 2: 130,137,394 D148G probably benign Het
Tgm6 A T 2: 130,141,208 Q239L probably benign Het
Thsd7a T A 6: 12,337,314 T1235S possibly damaging Het
Thsd7a T A 6: 12,504,013 I381F possibly damaging Het
Tmc4 T C 7: 3,671,271 probably null Het
Tmem54 A T 4: 129,110,911 E186D possibly damaging Het
Tpk1 A T 6: 43,611,335 F32I probably benign Het
Trpc4ap A G 2: 155,672,997 I97T probably benign Het
Txlnb A G 10: 17,843,194 E591G probably damaging Het
Tyk2 C T 9: 21,114,207 A741T probably damaging Het
Ubr4 G A 4: 139,406,518 E742K possibly damaging Het
Uckl1 A T 2: 181,574,868 S95T possibly damaging Het
Uevld T A 7: 46,937,986 D322V probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn1r238 G T 18: 3,123,300 T38K probably damaging Het
Vps8 T A 16: 21,444,188 probably null Het
Wdr60 T C 12: 116,256,211 E37G probably damaging Het
Wdr83 T C 8: 85,080,051 probably benign Het
Zcchc6 G A 13: 59,800,599 T636I possibly damaging Het
Zfp619 A G 7: 39,534,135 T51A probably benign Het
Other mutations in Mertk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01540:Mertk APN 2 128783967 missense probably damaging 1.00
IGL01561:Mertk APN 2 128736636 missense probably damaging 1.00
IGL01873:Mertk APN 2 128729275 missense possibly damaging 0.93
IGL02539:Mertk APN 2 128801290 missense probably damaging 1.00
IGL02652:Mertk APN 2 128801270 missense probably benign
IGL02962:Mertk APN 2 128777454 missense probably damaging 1.00
IGL03237:Mertk APN 2 128790272 missense probably damaging 1.00
PIT4378001:Mertk UTSW 2 128782617 critical splice donor site probably null
R0118:Mertk UTSW 2 128759166 missense probably damaging 0.99
R0281:Mertk UTSW 2 128782621 splice site probably benign
R0491:Mertk UTSW 2 128793107 critical splice donor site probably null
R0565:Mertk UTSW 2 128771483 missense probably benign 0.20
R0628:Mertk UTSW 2 128738313 missense probably damaging 1.00
R1260:Mertk UTSW 2 128762152 missense probably benign 0.03
R1406:Mertk UTSW 2 128771486 missense probably benign 0.00
R1406:Mertk UTSW 2 128771486 missense probably benign 0.00
R1423:Mertk UTSW 2 128778963 missense probably damaging 1.00
R1523:Mertk UTSW 2 128790328 critical splice donor site probably null
R1539:Mertk UTSW 2 128782526 missense probably benign 0.05
R1680:Mertk UTSW 2 128801636 missense probably benign 0.03
R1770:Mertk UTSW 2 128750174 missense probably benign 0.10
R1832:Mertk UTSW 2 128762212 missense probably benign 0.10
R1870:Mertk UTSW 2 128801196 missense probably benign 0.01
R1959:Mertk UTSW 2 128759090 missense probably damaging 0.98
R2078:Mertk UTSW 2 128794458 missense probably damaging 1.00
R2125:Mertk UTSW 2 128762138 missense probably benign
R2178:Mertk UTSW 2 128793064 missense probably damaging 1.00
R2220:Mertk UTSW 2 128801472 missense probably benign 0.18
R4128:Mertk UTSW 2 128777438 nonsense probably null
R4740:Mertk UTSW 2 128751994 missense probably damaging 1.00
R4822:Mertk UTSW 2 128801305 missense probably benign 0.00
R4839:Mertk UTSW 2 128782576 missense probably damaging 0.97
R4874:Mertk UTSW 2 128750159 missense probably damaging 1.00
R4899:Mertk UTSW 2 128783925 missense probably damaging 1.00
R5010:Mertk UTSW 2 128784000 missense probably benign 0.03
R5128:Mertk UTSW 2 128738247 missense probably damaging 0.97
R5251:Mertk UTSW 2 128729455 missense probably damaging 1.00
R5276:Mertk UTSW 2 128801314 missense possibly damaging 0.87
R5397:Mertk UTSW 2 128771464 missense possibly damaging 0.86
R5575:Mertk UTSW 2 128736565 missense probably damaging 1.00
R5605:Mertk UTSW 2 128738307 missense probably benign 0.43
R5705:Mertk UTSW 2 128771401 missense probably benign 0.00
R5987:Mertk UTSW 2 128771374 missense probably benign 0.01
R6127:Mertk UTSW 2 128738291 missense probably damaging 0.99
R6556:Mertk UTSW 2 128776421 missense probably benign 0.23
R6671:Mertk UTSW 2 128752023 critical splice donor site probably null
R6674:Mertk UTSW 2 128729357 missense probably benign
R6841:Mertk UTSW 2 128759230 splice site probably null
R7153:Mertk UTSW 2 128736649 missense probably damaging 0.99
R7192:Mertk UTSW 2 128793108 splice site probably null
R7225:Mertk UTSW 2 128801562 missense possibly damaging 0.94
R7344:Mertk UTSW 2 128771497 missense probably benign
R7414:Mertk UTSW 2 128729393 missense possibly damaging 0.95
R7883:Mertk UTSW 2 128776345 missense probably benign 0.01
R8000:Mertk UTSW 2 128771498 missense probably benign
X0067:Mertk UTSW 2 128729567 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCATTTCTTCCCACCCA -3'
(R):5'- GCCTGGTGTGCAAGAGGC -3'

Sequencing Primer
(F):5'- TTTCCATAAAAAGGTGAAGGAAATGC -3'
(R):5'- CAATGATGGAGTCAGGGTCAATGTTC -3'
Posted On2015-10-08