Mutagenetix > Incidental Mutation

Incidental Mutation 'R4664:Mertk'

353061

Institutional Source

Beutler Lab

Gene Symbol

Mertk

Ensembl Gene

ENSMUSG00000014361

Gene Name

c-mer proto-oncogene tyrosine kinase

Synonyms

Nyk, nmf12, Tyro 12, Eyk, Mer

MMRRC Submission

041922-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.117) question?

Stock #

R4664 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

128698956-128802894 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 128801212 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 844 (V844M)

Ref Sequence

ENSEMBL: ENSMUSP00000014505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014505]

AlphaFold

Q60805

Predicted Effect

probably benign
Transcript: ENSMUST00000014505
AA Change: V844M

PolyPhen 2 Score 0.241 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: V844M

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	94	189	8.99e-6	SMART
IG	198	276	1.54e-4	SMART
FN3	279	363	7.23e-8	SMART
FN3	379	465	6.16e-2	SMART
transmembrane domain	498	520	N/A	INTRINSIC
TyrKc	582	849	2.88e-129	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140221

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

96% (110/115)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano2	A	G	6: 125,863,538	I391V	probably benign	Het
Apc	T	A	18: 34,298,594	L349M	probably damaging	Het
Atmin	A	G	8: 116,957,959	D786G	probably damaging	Het
Atp8a1	T	A	5: 67,762,586	D379V	possibly damaging	Het
Aurkb	A	G	11: 69,048,609	K173E	probably damaging	Het
Bak1	T	C	17: 27,022,536	I83V	possibly damaging	Het
Btbd17	A	C	11: 114,794,006	V69G	probably damaging	Het
Cacna1a	T	A	8: 84,601,767	Y1597*	probably null	Het
Camk2a	C	A	18: 60,955,624	Q167K	possibly damaging	Het
Capn1	A	T	19: 6,011,015	N253K	probably benign	Het
Ccer2	A	G	7: 28,756,503	E40G	probably benign	Het
Cdc42bpa	A	G	1: 180,144,565	T527A	probably damaging	Het
Cdkl2	T	C	5: 92,037,265	D89G	probably damaging	Het
Cep128	G	T	12: 91,296,253	R291S	probably damaging	Het
Chd4	A	G	6: 125,101,502	M203V	possibly damaging	Het
Chrna4	A	G	2: 181,037,493	S54P	probably damaging	Het
Cic	TGTTGCCCTC	T	7: 25,290,674		probably benign	Het
Cntn5	T	A	9: 10,144,209	I152L	possibly damaging	Het
Cntn6	A	G	6: 104,728,284	E154G	probably benign	Het
Col16a1	A	C	4: 130,062,090		probably benign	Het
Col4a3bp	T	C	13: 96,599,457	V175A	probably benign	Het
Cpvl	C	T	6: 53,931,933	E282K	probably benign	Het
Cyth2	T	C	7: 45,810,719	D183G	probably damaging	Het
Ddx47	A	T	6: 135,012,356	T48S	possibly damaging	Het
Dgkk	A	G	X: 6,928,512	D685G	probably benign	Het
Dis3l	C	T	9: 64,330,798	S29N	unknown	Het
Dlg5	T	C	14: 24,137,181	H1834R	possibly damaging	Het
Dnah10	T	C	5: 124,828,472	M4060T	possibly damaging	Het
Dock3	T	A	9: 106,993,544	N557I	possibly damaging	Het
Eprs	A	T	1: 185,373,076		probably benign	Het
Faim2	C	A	15: 99,524,700		probably null	Het
Faim2	T	G	15: 99,524,701	S72R	probably benign	Het
Fam84b	A	T	15: 60,823,629	D89E	probably benign	Het
Fanca	T	C	8: 123,268,972	T1364A	probably damaging	Het
Fance	T	C	17: 28,315,662		probably benign	Het
Farsb	A	T	1: 78,443,765	H496Q	possibly damaging	Het
Fryl	C	T	5: 73,090,679	E1032K	possibly damaging	Het
Galnt14	A	T	17: 73,507,813		probably benign	Het
Gba2	A	T	4: 43,568,619		probably benign	Het
Gjb4	C	A	4: 127,351,778	K123N	probably damaging	Het
Gmcl1	G	A	6: 86,732,998	T56I	probably benign	Het
Gtf2ird1	T	A	5: 134,383,902	E55V	probably damaging	Het
Gtpbp2	T	C	17: 46,161,154	V5A	probably benign	Het
Hnrnpr	A	G	4: 136,317,175		probably benign	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Hsd3b3	T	C	3: 98,742,216	S264G	probably damaging	Het
Ints8	T	C	4: 11,227,152	M574V	probably benign	Het
Kif4-ps	G	A	12: 101,149,218		noncoding transcript	Het
Klhl14	A	T	18: 21,554,708	N552K	probably benign	Het
Klhl40	A	G	9: 121,780,733	E528G	probably damaging	Het
Lactb2	T	C	1: 13,647,400	E133G	probably damaging	Het
Lrrtm2	T	C	18: 35,214,257		probably null	Het
Mab21l2	T	A	3: 86,547,504	Y63F	probably benign	Het
Mbd1	T	A	18: 74,269,526	I33N	possibly damaging	Het
Mgea5	T	C	19: 45,771,945	E258G	probably benign	Het
Myh11	T	C	16: 14,226,584	T652A	possibly damaging	Het
Nlrp4a	C	A	7: 26,449,518	Y183*	probably null	Het
Noa1	T	A	5: 77,299,753	T558S	probably benign	Het
Nol11	A	T	11: 107,181,000	S256T	possibly damaging	Het
Nr1d1	G	T	11: 98,771,260	R183S	possibly damaging	Het
Nrg2	G	T	18: 36,052,895	Q264K	possibly damaging	Het
Nsd3	T	A	8: 25,698,866	F1027I	probably damaging	Het
Ntrk3	T	A	7: 78,461,099	I285F	probably damaging	Het
Obox8	T	C	7: 14,332,846	N91S	possibly damaging	Het
Orc5	C	T	5: 22,546,522	S63N	probably benign	Het
Osbpl6	C	T	2: 76,568,208	T412I	probably benign	Het
P2ry14	C	T	3: 59,115,142	C308Y	probably damaging	Het
Pacsin1	T	C	17: 27,707,064	F127L	probably damaging	Het
Pex11b	T	C	3: 96,643,835	L198P	possibly damaging	Het
Pla2g4e	A	T	2: 120,171,188	V660E	probably damaging	Het
Plxna4	C	A	6: 32,516,950	V244F	possibly damaging	Het
Polr3b	A	G	10: 84,714,369	Y981C	probably damaging	Het
Popdc2	T	A	16: 38,374,287	S357T	probably damaging	Het
Prr29	A	G	11: 106,376,333	H58R	probably damaging	Het
Pyy	T	A	11: 102,107,352	M1L	possibly damaging	Het
Rasd2	T	C	8: 75,221,928	S161P	possibly damaging	Het
Ryr3	C	T	2: 112,996,555		probably benign	Het
Sectm1a	G	A	11: 121,069,726	R88C	possibly damaging	Het
Serpinb13	C	T	1: 106,982,844	S66L	probably damaging	Het
Siglecf	A	T	7: 43,356,413	I465F	possibly damaging	Het
Sorl1	A	T	9: 42,004,051	M1294K	probably damaging	Het
Spam1	A	T	6: 24,796,662	H204L	probably benign	Het
Sspo	A	T	6: 48,473,534	N2586Y	possibly damaging	Het
Tbc1d4	A	G	14: 101,462,827		probably benign	Het
Tceanc2	A	T	4: 107,165,560	S77T	probably damaging	Het
Tedc2	A	G	17: 24,220,140		probably benign	Het
Tgm6	A	G	2: 130,137,394	D148G	probably benign	Het
Tgm6	A	T	2: 130,141,208	Q239L	probably benign	Het
Thsd7a	T	A	6: 12,337,314	T1235S	possibly damaging	Het
Thsd7a	T	A	6: 12,504,013	I381F	possibly damaging	Het
Tmc4	T	C	7: 3,671,271		probably null	Het
Tmem54	A	T	4: 129,110,911	E186D	possibly damaging	Het
Tpk1	A	T	6: 43,611,335	F32I	probably benign	Het
Trpc4ap	A	G	2: 155,672,997	I97T	probably benign	Het
Txlnb	A	G	10: 17,843,194	E591G	probably damaging	Het
Tyk2	C	T	9: 21,114,207	A741T	probably damaging	Het
Ubr4	G	A	4: 139,406,518	E742K	possibly damaging	Het
Uckl1	A	T	2: 181,574,868	S95T	possibly damaging	Het
Uevld	T	A	7: 46,937,986	D322V	probably damaging	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Vmn1r238	G	T	18: 3,123,300	T38K	probably damaging	Het
Vps8	T	A	16: 21,444,188		probably null	Het
Wdr60	T	C	12: 116,256,211	E37G	probably damaging	Het
Wdr83	T	C	8: 85,080,051		probably benign	Het
Zcchc6	G	A	13: 59,800,599	T636I	possibly damaging	Het
Zfp619	A	G	7: 39,534,135	T51A	probably benign	Het

Other mutations in Mertk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Mertk	APN	2	128783967	missense	probably damaging	1.00
IGL01561:Mertk	APN	2	128736636	missense	probably damaging	1.00
IGL01873:Mertk	APN	2	128729275	missense	possibly damaging	0.93
IGL02539:Mertk	APN	2	128801290	missense	probably damaging	1.00
IGL02652:Mertk	APN	2	128801270	missense	probably benign
IGL02962:Mertk	APN	2	128777454	missense	probably damaging	1.00
IGL03237:Mertk	APN	2	128790272	missense	probably damaging	1.00
PIT4378001:Mertk	UTSW	2	128782617	critical splice donor site	probably null
R0118:Mertk	UTSW	2	128759166	missense	probably damaging	0.99
R0281:Mertk	UTSW	2	128782621	splice site	probably benign
R0491:Mertk	UTSW	2	128793107	critical splice donor site	probably null
R0565:Mertk	UTSW	2	128771483	missense	probably benign	0.20
R0628:Mertk	UTSW	2	128738313	missense	probably damaging	1.00
R1260:Mertk	UTSW	2	128762152	missense	probably benign	0.03
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1423:Mertk	UTSW	2	128778963	missense	probably damaging	1.00
R1523:Mertk	UTSW	2	128790328	critical splice donor site	probably null
R1539:Mertk	UTSW	2	128782526	missense	probably benign	0.05
R1680:Mertk	UTSW	2	128801636	missense	probably benign	0.03
R1770:Mertk	UTSW	2	128750174	missense	probably benign	0.10
R1832:Mertk	UTSW	2	128762212	missense	probably benign	0.10
R1870:Mertk	UTSW	2	128801196	missense	probably benign	0.01
R1959:Mertk	UTSW	2	128759090	missense	probably damaging	0.98
R2078:Mertk	UTSW	2	128794458	missense	probably damaging	1.00
R2125:Mertk	UTSW	2	128762138	missense	probably benign
R2178:Mertk	UTSW	2	128793064	missense	probably damaging	1.00
R2220:Mertk	UTSW	2	128801472	missense	probably benign	0.18
R4128:Mertk	UTSW	2	128777438	nonsense	probably null
R4740:Mertk	UTSW	2	128751994	missense	probably damaging	1.00
R4822:Mertk	UTSW	2	128801305	missense	probably benign	0.00
R4839:Mertk	UTSW	2	128782576	missense	probably damaging	0.97
R4874:Mertk	UTSW	2	128750159	missense	probably damaging	1.00
R4899:Mertk	UTSW	2	128783925	missense	probably damaging	1.00
R5010:Mertk	UTSW	2	128784000	missense	probably benign	0.03
R5128:Mertk	UTSW	2	128738247	missense	probably damaging	0.97
R5251:Mertk	UTSW	2	128729455	missense	probably damaging	1.00
R5276:Mertk	UTSW	2	128801314	missense	possibly damaging	0.87
R5397:Mertk	UTSW	2	128771464	missense	possibly damaging	0.86
R5575:Mertk	UTSW	2	128736565	missense	probably damaging	1.00
R5605:Mertk	UTSW	2	128738307	missense	probably benign	0.43
R5705:Mertk	UTSW	2	128771401	missense	probably benign	0.00
R5987:Mertk	UTSW	2	128771374	missense	probably benign	0.01
R6127:Mertk	UTSW	2	128738291	missense	probably damaging	0.99
R6556:Mertk	UTSW	2	128776421	missense	probably benign	0.23
R6671:Mertk	UTSW	2	128752023	critical splice donor site	probably null
R6674:Mertk	UTSW	2	128729357	missense	probably benign
R6841:Mertk	UTSW	2	128759230	splice site	probably null
R7153:Mertk	UTSW	2	128736649	missense	probably damaging	0.99
R7192:Mertk	UTSW	2	128793108	splice site	probably null
R7225:Mertk	UTSW	2	128801562	missense	possibly damaging	0.94
R7344:Mertk	UTSW	2	128771497	missense	probably benign
R7414:Mertk	UTSW	2	128729393	missense	possibly damaging	0.95
R7883:Mertk	UTSW	2	128776345	missense	probably benign	0.01
R8000:Mertk	UTSW	2	128771498	missense	probably benign
R8953:Mertk	UTSW	2	128778796	intron	probably benign
R9135:Mertk	UTSW	2	128762115	missense	probably benign	0.23
R9153:Mertk	UTSW	2	128782567	missense	probably damaging	1.00
R9176:Mertk	UTSW	2	128778972	missense	possibly damaging	0.62
R9443:Mertk	UTSW	2	128762109	missense	probably benign	0.00
R9574:Mertk	UTSW	2	128751960	missense	probably benign	0.03
R9582:Mertk	UTSW	2	128782607	missense	possibly damaging	0.55
R9616:Mertk	UTSW	2	128801335	missense	probably benign	0.01
X0067:Mertk	UTSW	2	128729567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGACCATTTCTTCCCACCCA -3'
(R):5'- GCCTGGTGTGCAAGAGGC -3'

Sequencing Primer
(F):5'- TTTCCATAAAAAGGTGAAGGAAATGC -3'
(R):5'- CAATGATGGAGTCAGGGTCAATGTTC -3'

Posted On

2015-10-08