Incidental Mutation 'R4664:Fryl'
ID353081
Institutional Source Beutler Lab
Gene Symbol Fryl
Ensembl Gene ENSMUSG00000070733
Gene NameFRY like transcription coactivator
Synonyms2510002A14Rik, 2310004H21Rik, 9030227G01Rik
MMRRC Submission 041922-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.796) question?
Stock #R4664 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location73019987-73256619 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 73090679 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Lysine at position 1032 (E1032K)
Ref Sequence ENSEMBL: ENSMUSP00000098687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094700] [ENSMUST00000101127]
Predicted Effect possibly damaging
Transcript: ENSMUST00000094700
AA Change: E1032K

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000092289
Gene: ENSMUSG00000070733
AA Change: E1032K

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 117 649 5.7e-176 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 896 1141 1.3e-5 PFAM
Pfam:MOR2-PAG1_mid 1145 1331 2e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1450 1.2e-5 PFAM
low complexity region 1476 1487 N/A INTRINSIC
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1590 1660 1.1e-5 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 3.2e-15 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 2002 2255 9.9e-78 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101127
AA Change: E1032K

PolyPhen 2 Score 0.803 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000098687
Gene: ENSMUSG00000070733
AA Change: E1032K

DomainStartEndE-ValueType
Pfam:MOR2-PAG1_N 116 649 3e-172 PFAM
low complexity region 873 884 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 898 1115 7.8e-6 PFAM
Pfam:MOR2-PAG1_mid 1147 1331 9.5e-19 PFAM
Pfam:MOR2-PAG1_mid 1351 1503 1.1e-5 PFAM
low complexity region 1530 1548 N/A INTRINSIC
Pfam:MOR2-PAG1_mid 1589 1664 6e-6 PFAM
Pfam:MOR2-PAG1_mid 1725 1866 1.6e-14 PFAM
low complexity region 1973 1984 N/A INTRINSIC
Pfam:MOR2-PAG1_C 1998 2260 4.4e-76 PFAM
low complexity region 2329 2341 N/A INTRINSIC
low complexity region 2473 2482 N/A INTRINSIC
low complexity region 2485 2500 N/A INTRINSIC
low complexity region 2523 2534 N/A INTRINSIC
coiled coil region 2625 2649 N/A INTRINSIC
low complexity region 2827 2841 N/A INTRINSIC
coiled coil region 2854 2893 N/A INTRINSIC
coiled coil region 2963 2989 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000202381
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (110/115)
MGI Phenotype PHENOTYPE: Most mice homozygous for a knock-out allele exhibit postnatal lethality and defects in kidney development; rare survivors display growth retardation, decreased body weight, and premature death associated with chronic hydronephrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 A G 6: 125,863,538 I391V probably benign Het
Apc T A 18: 34,298,594 L349M probably damaging Het
Atmin A G 8: 116,957,959 D786G probably damaging Het
Atp8a1 T A 5: 67,762,586 D379V possibly damaging Het
Aurkb A G 11: 69,048,609 K173E probably damaging Het
Bak1 T C 17: 27,022,536 I83V possibly damaging Het
Btbd17 A C 11: 114,794,006 V69G probably damaging Het
Cacna1a T A 8: 84,601,767 Y1597* probably null Het
Camk2a C A 18: 60,955,624 Q167K possibly damaging Het
Capn1 A T 19: 6,011,015 N253K probably benign Het
Ccer2 A G 7: 28,756,503 E40G probably benign Het
Cdc42bpa A G 1: 180,144,565 T527A probably damaging Het
Cdkl2 T C 5: 92,037,265 D89G probably damaging Het
Cep128 G T 12: 91,296,253 R291S probably damaging Het
Chd4 A G 6: 125,101,502 M203V possibly damaging Het
Chrna4 A G 2: 181,037,493 S54P probably damaging Het
Cic TGTTGCCCTC T 7: 25,290,674 probably benign Het
Cntn5 T A 9: 10,144,209 I152L possibly damaging Het
Cntn6 A G 6: 104,728,284 E154G probably benign Het
Col16a1 A C 4: 130,062,090 probably benign Het
Col4a3bp T C 13: 96,599,457 V175A probably benign Het
Cpvl C T 6: 53,931,933 E282K probably benign Het
Cyth2 T C 7: 45,810,719 D183G probably damaging Het
Ddx47 A T 6: 135,012,356 T48S possibly damaging Het
Dgkk A G X: 6,928,512 D685G probably benign Het
Dis3l C T 9: 64,330,798 S29N unknown Het
Dlg5 T C 14: 24,137,181 H1834R possibly damaging Het
Dnah10 T C 5: 124,828,472 M4060T possibly damaging Het
Dock3 T A 9: 106,993,544 N557I possibly damaging Het
Eprs A T 1: 185,373,076 probably benign Het
Faim2 C A 15: 99,524,700 probably null Het
Faim2 T G 15: 99,524,701 S72R probably benign Het
Fam84b A T 15: 60,823,629 D89E probably benign Het
Fanca T C 8: 123,268,972 T1364A probably damaging Het
Fance T C 17: 28,315,662 probably benign Het
Farsb A T 1: 78,443,765 H496Q possibly damaging Het
Galnt14 A T 17: 73,507,813 probably benign Het
Gba2 A T 4: 43,568,619 probably benign Het
Gjb4 C A 4: 127,351,778 K123N probably damaging Het
Gmcl1 G A 6: 86,732,998 T56I probably benign Het
Gtf2ird1 T A 5: 134,383,902 E55V probably damaging Het
Gtpbp2 T C 17: 46,161,154 V5A probably benign Het
Hnrnpr A G 4: 136,317,175 probably null Het
Homer3 G A 8: 70,290,143 probably null Het
Hsd3b3 T C 3: 98,742,216 S264G probably damaging Het
Ints8 T C 4: 11,227,152 M574V probably benign Het
Kif4-ps G A 12: 101,149,218 noncoding transcript Het
Klhl14 A T 18: 21,554,708 N552K probably benign Het
Klhl40 A G 9: 121,780,733 E528G probably damaging Het
Lactb2 T C 1: 13,647,400 E133G probably damaging Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mab21l2 T A 3: 86,547,504 Y63F probably benign Het
Mbd1 T A 18: 74,269,526 I33N possibly damaging Het
Mertk G A 2: 128,801,212 V844M probably benign Het
Mgea5 T C 19: 45,771,945 E258G probably benign Het
Myh11 T C 16: 14,226,584 T652A possibly damaging Het
Nlrp4a C A 7: 26,449,518 Y183* probably null Het
Noa1 T A 5: 77,299,753 T558S probably benign Het
Nol11 A T 11: 107,181,000 S256T possibly damaging Het
Nr1d1 G T 11: 98,771,260 R183S possibly damaging Het
Nrg2 G T 18: 36,052,895 Q264K possibly damaging Het
Nsd3 T A 8: 25,698,866 F1027I probably damaging Het
Ntrk3 T A 7: 78,461,099 I285F probably damaging Het
Obox8 T C 7: 14,332,846 N91S possibly damaging Het
Orc5 C T 5: 22,546,522 S63N probably benign Het
Osbpl6 C T 2: 76,568,208 T412I probably benign Het
P2ry14 C T 3: 59,115,142 C308Y probably damaging Het
Pacsin1 T C 17: 27,707,064 F127L probably damaging Het
Pex11b T C 3: 96,643,835 L198P possibly damaging Het
Pla2g4e A T 2: 120,171,188 V660E probably damaging Het
Plxna4 C A 6: 32,516,950 V244F possibly damaging Het
Polr3b A G 10: 84,714,369 Y981C probably damaging Het
Popdc2 T A 16: 38,374,287 S357T probably damaging Het
Prr29 A G 11: 106,376,333 H58R probably damaging Het
Pyy T A 11: 102,107,352 M1L possibly damaging Het
Rasd2 T C 8: 75,221,928 S161P possibly damaging Het
Ryr3 C T 2: 112,996,555 probably benign Het
Sectm1a G A 11: 121,069,726 R88C possibly damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Siglecf A T 7: 43,356,413 I465F possibly damaging Het
Sorl1 A T 9: 42,004,051 M1294K probably damaging Het
Spam1 A T 6: 24,796,662 H204L probably benign Het
Sspo A T 6: 48,473,534 N2586Y possibly damaging Het
Tbc1d4 A G 14: 101,462,827 probably benign Het
Tceanc2 A T 4: 107,165,560 S77T probably damaging Het
Tedc2 A G 17: 24,220,140 probably benign Het
Tgm6 A G 2: 130,137,394 D148G probably benign Het
Tgm6 A T 2: 130,141,208 Q239L probably benign Het
Thsd7a T A 6: 12,337,314 T1235S possibly damaging Het
Thsd7a T A 6: 12,504,013 I381F possibly damaging Het
Tmc4 T C 7: 3,671,271 probably null Het
Tmem54 A T 4: 129,110,911 E186D possibly damaging Het
Tpk1 A T 6: 43,611,335 F32I probably benign Het
Trpc4ap A G 2: 155,672,997 I97T probably benign Het
Txlnb A G 10: 17,843,194 E591G probably damaging Het
Tyk2 C T 9: 21,114,207 A741T probably damaging Het
Ubr4 G A 4: 139,406,518 E742K possibly damaging Het
Uckl1 A T 2: 181,574,868 S95T possibly damaging Het
Uevld T A 7: 46,937,986 D322V probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn1r238 G T 18: 3,123,300 T38K probably damaging Het
Vps8 T A 16: 21,444,188 probably null Het
Wdr60 T C 12: 116,256,211 E37G probably damaging Het
Wdr83 T C 8: 85,080,051 probably benign Het
Zcchc6 G A 13: 59,800,599 T636I possibly damaging Het
Zfp619 A G 7: 39,534,135 T51A probably benign Het
Other mutations in Fryl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00819:Fryl APN 5 73148108 missense possibly damaging 0.92
IGL01518:Fryl APN 5 73086962 missense possibly damaging 0.76
IGL01545:Fryl APN 5 73054597 missense probably damaging 1.00
IGL01646:Fryl APN 5 73022501 critical splice donor site probably null
IGL01938:Fryl APN 5 73122364 missense probably damaging 0.98
IGL01962:Fryl APN 5 73032791 missense possibly damaging 0.62
IGL02064:Fryl APN 5 73124769 unclassified probably benign
IGL02148:Fryl APN 5 73075959 missense probably benign 0.35
IGL02418:Fryl APN 5 73110176 splice site probably benign
IGL02431:Fryl APN 5 73098308 missense probably benign 0.02
IGL02513:Fryl APN 5 73065293 missense probably damaging 1.00
IGL02557:Fryl APN 5 73098393 missense probably damaging 1.00
IGL02625:Fryl APN 5 73069877 intron probably benign
IGL02642:Fryl APN 5 73095466 missense probably benign
IGL02657:Fryl APN 5 73054860 missense probably benign 0.01
IGL02706:Fryl APN 5 73093163 missense probably benign 0.45
IGL03022:Fryl APN 5 73059383 missense possibly damaging 0.82
IGL03144:Fryl APN 5 73101455 missense probably null 0.22
IGL03155:Fryl APN 5 73076695 missense probably benign
IGL03183:Fryl APN 5 73076695 missense probably benign
IGL03275:Fryl APN 5 73148033 missense possibly damaging 0.47
IGL03310:Fryl APN 5 73136316 splice site probably benign
IGL03341:Fryl APN 5 73076695 missense probably benign
IGL03343:Fryl APN 5 73076695 missense probably benign
IGL03350:Fryl APN 5 73133306 missense probably damaging 0.99
IGL03357:Fryl APN 5 73054059 missense probably damaging 1.00
IGL03374:Fryl APN 5 73110281 splice site probably benign
IGL03375:Fryl APN 5 73088449 missense possibly damaging 0.91
bedeviled UTSW 5 73059500 missense probably damaging 1.00
Besotted UTSW 5 73072912 missense probably damaging 1.00
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0062:Fryl UTSW 5 73022278 missense probably benign 0.02
R0308:Fryl UTSW 5 73041604 splice site probably benign
R0312:Fryl UTSW 5 73072888 missense probably damaging 1.00
R0415:Fryl UTSW 5 73098414 missense probably damaging 0.99
R0440:Fryl UTSW 5 73086972 missense possibly damaging 0.91
R0446:Fryl UTSW 5 73097417 missense possibly damaging 0.91
R0566:Fryl UTSW 5 73064497 splice site probably benign
R0567:Fryl UTSW 5 73065391 missense possibly damaging 0.50
R0606:Fryl UTSW 5 73124734 missense probably benign 0.15
R0619:Fryl UTSW 5 73068731 missense probably benign 0.22
R0654:Fryl UTSW 5 73083372 missense probably benign 0.17
R0658:Fryl UTSW 5 73065359 missense probably damaging 1.00
R0707:Fryl UTSW 5 73083372 missense probably benign 0.17
R0744:Fryl UTSW 5 73089081 unclassified probably benign
R0745:Fryl UTSW 5 73071126 missense probably damaging 0.96
R0833:Fryl UTSW 5 73089081 unclassified probably benign
R0885:Fryl UTSW 5 73089196 missense probably damaging 0.97
R0894:Fryl UTSW 5 73041332 splice site probably benign
R1076:Fryl UTSW 5 73124673 unclassified probably benign
R1241:Fryl UTSW 5 73064925 splice site probably benign
R1241:Fryl UTSW 5 73110271 missense probably damaging 1.00
R1394:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1395:Fryl UTSW 5 73072912 missense probably damaging 1.00
R1608:Fryl UTSW 5 73074751 nonsense probably null
R1664:Fryl UTSW 5 73059435 missense probably damaging 1.00
R1745:Fryl UTSW 5 73032861 splice site probably benign
R1937:Fryl UTSW 5 73133367 missense probably damaging 1.00
R1969:Fryl UTSW 5 73098266 missense probably benign 0.18
R1993:Fryl UTSW 5 73108493 missense probably damaging 1.00
R1994:Fryl UTSW 5 73108493 missense probably damaging 1.00
R2029:Fryl UTSW 5 73022122 nonsense probably null
R2036:Fryl UTSW 5 73022544 missense probably benign
R2036:Fryl UTSW 5 73107962 critical splice donor site probably null
R2088:Fryl UTSW 5 73065461 missense probably benign 0.02
R2105:Fryl UTSW 5 73122299 missense probably benign
R2106:Fryl UTSW 5 73098331 missense probably damaging 1.00
R2186:Fryl UTSW 5 73064975 missense probably damaging 1.00
R2239:Fryl UTSW 5 73108547 missense probably damaging 0.99
R2256:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2257:Fryl UTSW 5 73072844 missense possibly damaging 0.47
R2280:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2281:Fryl UTSW 5 73041364 missense possibly damaging 0.47
R2911:Fryl UTSW 5 73050456 missense probably damaging 0.99
R3019:Fryl UTSW 5 73082850 missense probably benign 0.01
R3416:Fryl UTSW 5 73108074 missense possibly damaging 0.84
R3783:Fryl UTSW 5 73101476 missense probably benign
R3787:Fryl UTSW 5 73101476 missense probably benign
R3837:Fryl UTSW 5 73071265 missense probably benign 0.03
R3969:Fryl UTSW 5 73112423 missense probably damaging 0.97
R4387:Fryl UTSW 5 73086560 missense possibly damaging 0.91
R4502:Fryl UTSW 5 73088397 missense probably damaging 1.00
R4658:Fryl UTSW 5 73081053 missense probably damaging 1.00
R4690:Fryl UTSW 5 73100293 missense probably benign
R4700:Fryl UTSW 5 73065538 missense possibly damaging 0.88
R4709:Fryl UTSW 5 73080972 missense probably benign 0.03
R4807:Fryl UTSW 5 73041362 missense probably benign 0.00
R4912:Fryl UTSW 5 73068782 frame shift probably null
R4948:Fryl UTSW 5 73089130 missense probably benign 0.08
R4959:Fryl UTSW 5 73035058 missense probably benign 0.00
R5062:Fryl UTSW 5 73075893 missense possibly damaging 0.89
R5067:Fryl UTSW 5 73057755 missense probably benign 0.13
R5071:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5072:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5073:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5074:Fryl UTSW 5 73074767 missense probably damaging 0.99
R5139:Fryl UTSW 5 73090718 missense probably damaging 1.00
R5172:Fryl UTSW 5 73101673 missense possibly damaging 0.95
R5187:Fryl UTSW 5 73086600 missense possibly damaging 0.95
R5272:Fryl UTSW 5 73065136 nonsense probably null
R5275:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5295:Fryl UTSW 5 73112791 missense probably damaging 1.00
R5344:Fryl UTSW 5 73104774 missense probably damaging 1.00
R5355:Fryl UTSW 5 73073904 missense probably damaging 1.00
R5716:Fryl UTSW 5 73100465 missense probably benign
R5778:Fryl UTSW 5 73072778 missense probably damaging 1.00
R5810:Fryl UTSW 5 73090755 missense probably benign 0.06
R5934:Fryl UTSW 5 73090717 missense probably damaging 1.00
R5948:Fryl UTSW 5 73097372 critical splice donor site probably null
R6005:Fryl UTSW 5 73083295 missense probably damaging 1.00
R6026:Fryl UTSW 5 73099997 missense probably benign 0.04
R6045:Fryl UTSW 5 73118551 missense probably damaging 0.99
R6185:Fryl UTSW 5 73112788 missense probably benign 0.43
R6247:Fryl UTSW 5 73065481 missense probably damaging 0.98
R6294:Fryl UTSW 5 73191759 intron probably benign
R6310:Fryl UTSW 5 73191761 intron probably benign
R6429:Fryl UTSW 5 73090751 missense possibly damaging 0.84
R6568:Fryl UTSW 5 73059516 missense probably damaging 1.00
R6636:Fryl UTSW 5 73133312 missense probably benign 0.01
R6664:Fryl UTSW 5 73132481 missense probably damaging 1.00
R6732:Fryl UTSW 5 73054781 missense probably damaging 1.00
R6750:Fryl UTSW 5 73022232 missense probably damaging 1.00
R6805:Fryl UTSW 5 73065094 missense probably benign 0.03
R6823:Fryl UTSW 5 73065217 missense probably damaging 0.99
R6855:Fryl UTSW 5 73059500 missense probably damaging 1.00
R6858:Fryl UTSW 5 73065032 missense probably damaging 1.00
R6868:Fryl UTSW 5 73068803 missense probably damaging 1.00
R6898:Fryl UTSW 5 73022142 missense probably damaging 0.96
R6908:Fryl UTSW 5 73022211 missense probably damaging 1.00
R6958:Fryl UTSW 5 73073929 missense possibly damaging 0.89
R6980:Fryl UTSW 5 73050430 missense probably benign 0.06
R7036:Fryl UTSW 5 73055608 missense probably benign 0.03
R7065:Fryl UTSW 5 73090756 missense probably damaging 0.96
R7097:Fryl UTSW 5 73073908 missense probably benign 0.31
R7171:Fryl UTSW 5 73122310 missense probably damaging 0.97
R7191:Fryl UTSW 5 73072912 missense probably damaging 1.00
R7207:Fryl UTSW 5 73065095 missense probably benign
R7236:Fryl UTSW 5 73108478 missense possibly damaging 0.66
R7334:Fryl UTSW 5 73047496 intron probably null
R7425:Fryl UTSW 5 73104748 missense probably damaging 1.00
R7452:Fryl UTSW 5 73023988 missense probably damaging 1.00
R7479:Fryl UTSW 5 73097561 missense possibly damaging 0.71
R7535:Fryl UTSW 5 73098196 missense probably benign 0.15
R7538:Fryl UTSW 5 73022676 missense probably benign 0.09
R7544:Fryl UTSW 5 73081039 missense probably benign
R7548:Fryl UTSW 5 73191762 missense unknown
R7565:Fryl UTSW 5 73033720 missense probably benign 0.18
R7572:Fryl UTSW 5 73088396 missense possibly damaging 0.91
R7582:Fryl UTSW 5 73022500 critical splice donor site probably null
R7630:Fryl UTSW 5 73110245 missense possibly damaging 0.62
R7774:Fryl UTSW 5 73083384 missense probably benign 0.12
R7777:Fryl UTSW 5 73071298 missense probably damaging 0.98
Z1088:Fryl UTSW 5 73090709 missense probably damaging 0.99
Z1088:Fryl UTSW 5 73090738 missense probably damaging 1.00
Z1176:Fryl UTSW 5 73072837 missense not run
Z1177:Fryl UTSW 5 73041595 critical splice acceptor site unknown
Predicted Primers PCR Primer
(F):5'- CACATTTATTTATGTGCGGGCAC -3'
(R):5'- ACAAGCACACCAGGTTTGC -3'

Sequencing Primer
(F):5'- CATGTGTGAACATGCCTCAG -3'
(R):5'- CCGCGTGTCCTTCTGATGG -3'
Posted On2015-10-08