Incidental Mutation 'R4664:Spam1'
ID353088
Institutional Source Beutler Lab
Gene Symbol Spam1
Ensembl Gene ENSMUSG00000029682
Gene Namesperm adhesion molecule 1
SynonymsPh-20
MMRRC Submission 041922-MU
Accession Numbers

Genbank: NM_001079875.1, NM_009241.2

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4664 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location24791188-24801048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24796662 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 204 (H204L)
Ref Sequence ENSEMBL: ENSMUSP00000143970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031693] [ENSMUST00000202331] [ENSMUST00000202569]
Predicted Effect probably benign
Transcript: ENSMUST00000031693
AA Change: H204L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000031693
Gene: ENSMUSG00000029682
AA Change: H204L

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 42 373 4.5e-136 PFAM
Blast:EGF 376 439 5e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000202331
AA Change: H204L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000143944
Gene: ENSMUSG00000029682
AA Change: H204L

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 42 373 4.5e-136 PFAM
Blast:EGF 376 439 5e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000202569
AA Change: H204L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000143970
Gene: ENSMUSG00000029682
AA Change: H204L

DomainStartEndE-ValueType
Pfam:Glyco_hydro_56 42 373 4.5e-136 PFAM
Blast:EGF 376 439 5e-13 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202786
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (110/115)
MGI Phenotype PHENOTYPE: Male homozygotes for a targeted null mutation are normally fertile, but in vitro their sperm are slower at clearing cells from the cumulus mass. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 A G 6: 125,863,538 I391V probably benign Het
Apc T A 18: 34,298,594 L349M probably damaging Het
Atmin A G 8: 116,957,959 D786G probably damaging Het
Atp8a1 T A 5: 67,762,586 D379V possibly damaging Het
Aurkb A G 11: 69,048,609 K173E probably damaging Het
Bak1 T C 17: 27,022,536 I83V possibly damaging Het
Btbd17 A C 11: 114,794,006 V69G probably damaging Het
Cacna1a T A 8: 84,601,767 Y1597* probably null Het
Camk2a C A 18: 60,955,624 Q167K possibly damaging Het
Capn1 A T 19: 6,011,015 N253K probably benign Het
Ccer2 A G 7: 28,756,503 E40G probably benign Het
Cdc42bpa A G 1: 180,144,565 T527A probably damaging Het
Cdkl2 T C 5: 92,037,265 D89G probably damaging Het
Cep128 G T 12: 91,296,253 R291S probably damaging Het
Chd4 A G 6: 125,101,502 M203V possibly damaging Het
Chrna4 A G 2: 181,037,493 S54P probably damaging Het
Cic TGTTGCCCTC T 7: 25,290,674 probably benign Het
Cntn5 T A 9: 10,144,209 I152L possibly damaging Het
Cntn6 A G 6: 104,728,284 E154G probably benign Het
Col16a1 A C 4: 130,062,090 probably benign Het
Col4a3bp T C 13: 96,599,457 V175A probably benign Het
Cpvl C T 6: 53,931,933 E282K probably benign Het
Cyth2 T C 7: 45,810,719 D183G probably damaging Het
Ddx47 A T 6: 135,012,356 T48S possibly damaging Het
Dgkk A G X: 6,928,512 D685G probably benign Het
Dis3l C T 9: 64,330,798 S29N unknown Het
Dlg5 T C 14: 24,137,181 H1834R possibly damaging Het
Dnah10 T C 5: 124,828,472 M4060T possibly damaging Het
Dock3 T A 9: 106,993,544 N557I possibly damaging Het
Eprs A T 1: 185,373,076 probably benign Het
Faim2 C A 15: 99,524,700 probably null Het
Faim2 T G 15: 99,524,701 S72R probably benign Het
Fam84b A T 15: 60,823,629 D89E probably benign Het
Fanca T C 8: 123,268,972 T1364A probably damaging Het
Fance T C 17: 28,315,662 probably benign Het
Farsb A T 1: 78,443,765 H496Q possibly damaging Het
Fryl C T 5: 73,090,679 E1032K possibly damaging Het
Galnt14 A T 17: 73,507,813 probably benign Het
Gba2 A T 4: 43,568,619 probably benign Het
Gjb4 C A 4: 127,351,778 K123N probably damaging Het
Gmcl1 G A 6: 86,732,998 T56I probably benign Het
Gtf2ird1 T A 5: 134,383,902 E55V probably damaging Het
Gtpbp2 T C 17: 46,161,154 V5A probably benign Het
Hnrnpr A G 4: 136,317,175 probably null Het
Homer3 G A 8: 70,290,143 probably null Het
Hsd3b3 T C 3: 98,742,216 S264G probably damaging Het
Ints8 T C 4: 11,227,152 M574V probably benign Het
Kif4-ps G A 12: 101,149,218 noncoding transcript Het
Klhl14 A T 18: 21,554,708 N552K probably benign Het
Klhl40 A G 9: 121,780,733 E528G probably damaging Het
Lactb2 T C 1: 13,647,400 E133G probably damaging Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mab21l2 T A 3: 86,547,504 Y63F probably benign Het
Mbd1 T A 18: 74,269,526 I33N possibly damaging Het
Mertk G A 2: 128,801,212 V844M probably benign Het
Mgea5 T C 19: 45,771,945 E258G probably benign Het
Myh11 T C 16: 14,226,584 T652A possibly damaging Het
Nlrp4a C A 7: 26,449,518 Y183* probably null Het
Noa1 T A 5: 77,299,753 T558S probably benign Het
Nol11 A T 11: 107,181,000 S256T possibly damaging Het
Nr1d1 G T 11: 98,771,260 R183S possibly damaging Het
Nrg2 G T 18: 36,052,895 Q264K possibly damaging Het
Nsd3 T A 8: 25,698,866 F1027I probably damaging Het
Ntrk3 T A 7: 78,461,099 I285F probably damaging Het
Obox8 T C 7: 14,332,846 N91S possibly damaging Het
Orc5 C T 5: 22,546,522 S63N probably benign Het
Osbpl6 C T 2: 76,568,208 T412I probably benign Het
P2ry14 C T 3: 59,115,142 C308Y probably damaging Het
Pacsin1 T C 17: 27,707,064 F127L probably damaging Het
Pex11b T C 3: 96,643,835 L198P possibly damaging Het
Pla2g4e A T 2: 120,171,188 V660E probably damaging Het
Plxna4 C A 6: 32,516,950 V244F possibly damaging Het
Polr3b A G 10: 84,714,369 Y981C probably damaging Het
Popdc2 T A 16: 38,374,287 S357T probably damaging Het
Prr29 A G 11: 106,376,333 H58R probably damaging Het
Pyy T A 11: 102,107,352 M1L possibly damaging Het
Rasd2 T C 8: 75,221,928 S161P possibly damaging Het
Ryr3 C T 2: 112,996,555 probably benign Het
Sectm1a G A 11: 121,069,726 R88C possibly damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Siglecf A T 7: 43,356,413 I465F possibly damaging Het
Sorl1 A T 9: 42,004,051 M1294K probably damaging Het
Sspo A T 6: 48,473,534 N2586Y possibly damaging Het
Tbc1d4 A G 14: 101,462,827 probably benign Het
Tceanc2 A T 4: 107,165,560 S77T probably damaging Het
Tedc2 A G 17: 24,220,140 probably benign Het
Tgm6 A G 2: 130,137,394 D148G probably benign Het
Tgm6 A T 2: 130,141,208 Q239L probably benign Het
Thsd7a T A 6: 12,337,314 T1235S possibly damaging Het
Thsd7a T A 6: 12,504,013 I381F possibly damaging Het
Tmc4 T C 7: 3,671,271 probably null Het
Tmem54 A T 4: 129,110,911 E186D possibly damaging Het
Tpk1 A T 6: 43,611,335 F32I probably benign Het
Trpc4ap A G 2: 155,672,997 I97T probably benign Het
Txlnb A G 10: 17,843,194 E591G probably damaging Het
Tyk2 C T 9: 21,114,207 A741T probably damaging Het
Ubr4 G A 4: 139,406,518 E742K possibly damaging Het
Uckl1 A T 2: 181,574,868 S95T possibly damaging Het
Uevld T A 7: 46,937,986 D322V probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn1r238 G T 18: 3,123,300 T38K probably damaging Het
Vps8 T A 16: 21,444,188 probably null Het
Wdr60 T C 12: 116,256,211 E37G probably damaging Het
Wdr83 T C 8: 85,080,051 probably benign Het
Zcchc6 G A 13: 59,800,599 T636I possibly damaging Het
Zfp619 A G 7: 39,534,135 T51A probably benign Het
Other mutations in Spam1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00535:Spam1 APN 6 24796723 nonsense probably null
IGL02152:Spam1 APN 6 24800803 utr 3 prime probably benign
IGL02377:Spam1 APN 6 24796697 missense probably damaging 1.00
IGL02666:Spam1 APN 6 24796124 missense possibly damaging 0.67
IGL02968:Spam1 APN 6 24796443 missense possibly damaging 0.84
IGL03004:Spam1 APN 6 24796914 missense probably damaging 1.00
IGL03136:Spam1 APN 6 24797011 splice site probably benign
I2288:Spam1 UTSW 6 24796478 missense probably benign 0.00
I2289:Spam1 UTSW 6 24796478 missense probably benign 0.00
R0279:Spam1 UTSW 6 24800419 missense probably benign
R0454:Spam1 UTSW 6 24797838 missense probably damaging 0.99
R0486:Spam1 UTSW 6 24796395 missense probably damaging 1.00
R0734:Spam1 UTSW 6 24796949 missense probably benign 0.17
R0811:Spam1 UTSW 6 24796887 missense probably damaging 1.00
R0812:Spam1 UTSW 6 24796887 missense probably damaging 1.00
R1294:Spam1 UTSW 6 24796907 missense probably benign 0.12
R1703:Spam1 UTSW 6 24796257 missense probably damaging 1.00
R2156:Spam1 UTSW 6 24796268 missense probably damaging 1.00
R2163:Spam1 UTSW 6 24796847 missense probably benign 0.33
R2762:Spam1 UTSW 6 24796643 missense possibly damaging 0.94
R2970:Spam1 UTSW 6 24796725 missense probably damaging 1.00
R4646:Spam1 UTSW 6 24800587 missense probably benign 0.01
R4923:Spam1 UTSW 6 24796656 missense probably damaging 1.00
R5452:Spam1 UTSW 6 24800732 missense probably benign 0.00
R5589:Spam1 UTSW 6 24796110 missense probably benign 0.01
R5591:Spam1 UTSW 6 24800546 missense probably damaging 0.99
R5861:Spam1 UTSW 6 24796571 missense probably benign
R6481:Spam1 UTSW 6 24796930 missense probably benign 0.01
R6564:Spam1 UTSW 6 24796356 missense possibly damaging 0.90
R6754:Spam1 UTSW 6 24796316 missense probably damaging 0.97
R7103:Spam1 UTSW 6 24800584 missense probably benign 0.00
R7462:Spam1 UTSW 6 24796908 missense probably damaging 0.99
R7559:Spam1 UTSW 6 24800453 missense probably damaging 1.00
X0022:Spam1 UTSW 6 24797886 missense possibly damaging 0.52
Z1176:Spam1 UTSW 6 24800323 missense not run
Predicted Primers PCR Primer
(F):5'- GACGACAAATTGGGCTTAGC -3'
(R):5'- GCTTGTCGATTGGACTTCAAGTC -3'

Sequencing Primer
(F):5'- CGACAAATTGGGCTTAGCTATCATTG -3'
(R):5'- GTCTTTCTTCAAATAGACAGATGGG -3'
Posted On2015-10-08