Mutagenetix > Incidental Mutations

Incidental Mutation 'R4664:Cic'

353098

Institutional Source

Beutler Lab

Gene Symbol

Cic

Ensembl Gene

ENSMUSG00000005442

Gene Name

capicua transcriptional repressor

Synonyms

1200010B10Rik

MMRRC Submission

041922-MU

Accession Numbers

Genbank: NM_027882.3, NM_001110131.1, NM_001110132.1; Ensembl: ENSMUST00000169266

Is this an essential gene?

Probably essential (E-score: 0.897) question?

Stock #

R4664 (G1)

Quality Score

217

Status

Validated

Chromosome

Chromosomal Location

25267704-25294159 bp(+) (GRCm38)

Type of Mutation

small deletion (3 aa in frame mutation)

DNA Base Change (assembly)

TGTTGCCCTC to T at 25290674 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000132351 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000005578] [ENSMUST00000005583] [ENSMUST00000108410] [ENSMUST00000148150] [ENSMUST00000163320] [ENSMUST00000164820] [ENSMUST00000165239] [ENSMUST00000169266]

Predicted Effect

probably benign
Transcript: ENSMUST00000005578

SMART Domains

Protein: ENSMUSP00000005578
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	6e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1065	1080	N/A	INTRINSIC
low complexity region	1118	1132	N/A	INTRINSIC
low complexity region	1135	1155	N/A	INTRINSIC
low complexity region	1223	1253	N/A	INTRINSIC
low complexity region	1280	1313	N/A	INTRINSIC
low complexity region	1405	1418	N/A	INTRINSIC
low complexity region	1483	1494	N/A	INTRINSIC
low complexity region	1524	1547	N/A	INTRINSIC
low complexity region	1568	1603	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000005583

SMART Domains

Protein: ENSMUSP00000005583
Gene: ENSMUSG00000005447

Domain	Start	End	E-Value	Type
Pfam:Lipase_GDSL_2	12	203	3.8e-13	PFAM
Pfam:Lipase_GDSL	42	209	1.2e-8	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000108410

SMART Domains

Protein: ENSMUSP00000104048
Gene: ENSMUSG00000005447

Domain	Start	End	E-Value	Type
Pfam:Lipase_GDSL_2	4	151	1.2e-23	PFAM
low complexity region	155	166	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140093

Predicted Effect

probably benign
Transcript: ENSMUST00000148150

SMART Domains

Protein: ENSMUSP00000121250
Gene: ENSMUSG00000005447

Domain	Start	End	E-Value	Type
Pfam:Lipase_GDSL_2	43	143	5.5e-14	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163320

SMART Domains

Protein: ENSMUSP00000126659
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	6e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1064	1079	N/A	INTRINSIC
low complexity region	1117	1131	N/A	INTRINSIC
low complexity region	1134	1154	N/A	INTRINSIC
low complexity region	1222	1252	N/A	INTRINSIC
low complexity region	1279	1312	N/A	INTRINSIC
low complexity region	1405	1418	N/A	INTRINSIC
low complexity region	1483	1494	N/A	INTRINSIC
low complexity region	1524	1547	N/A	INTRINSIC
low complexity region	1568	1603	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163901

SMART Domains

Protein: ENSMUSP00000127858
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
low complexity region	24	35	N/A	INTRINSIC
low complexity region	114	128	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000164820

SMART Domains

Protein: ENSMUSP00000130146
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
low complexity region	22	36	N/A	INTRINSIC
low complexity region	39	57	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000165239

SMART Domains

Protein: ENSMUSP00000128071
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
PDB:4J2L\|D	21	48	5e-12	PDB
low complexity region	106	120	N/A	INTRINSIC
low complexity region	124	138	N/A	INTRINSIC
HMG	199	269	1.24e-17	SMART
low complexity region	415	431	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	508	521	N/A	INTRINSIC
low complexity region	525	555	N/A	INTRINSIC
low complexity region	567	583	N/A	INTRINSIC
low complexity region	645	660	N/A	INTRINSIC
low complexity region	729	740	N/A	INTRINSIC
low complexity region	782	803	N/A	INTRINSIC
low complexity region	837	859	N/A	INTRINSIC
low complexity region	939	951	N/A	INTRINSIC
low complexity region	1065	1080	N/A	INTRINSIC
low complexity region	1118	1132	N/A	INTRINSIC
low complexity region	1135	1153	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000165742

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167162

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000167379

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000168956

Predicted Effect

probably benign
Transcript: ENSMUST00000169266

SMART Domains

Protein: ENSMUSP00000132351
Gene: ENSMUSG00000005442

Domain	Start	End	E-Value	Type
low complexity region	9	23	N/A	INTRINSIC
low complexity region	33	73	N/A	INTRINSIC
low complexity region	151	165	N/A	INTRINSIC
Pfam:DUF4819	249	346	1.8e-23	PFAM
low complexity region	351	367	N/A	INTRINSIC
low complexity region	403	427	N/A	INTRINSIC
low complexity region	445	457	N/A	INTRINSIC
low complexity region	462	475	N/A	INTRINSIC
low complexity region	618	633	N/A	INTRINSIC
low complexity region	673	685	N/A	INTRINSIC
low complexity region	724	734	N/A	INTRINSIC
low complexity region	740	751	N/A	INTRINSIC
low complexity region	779	786	N/A	INTRINSIC
low complexity region	858	883	N/A	INTRINSIC
low complexity region	898	911	N/A	INTRINSIC
PDB:4J2L\|D	930	955	5e-10	PDB
low complexity region	1013	1027	N/A	INTRINSIC
low complexity region	1031	1045	N/A	INTRINSIC
HMG	1106	1176	1.24e-17	SMART
low complexity region	1322	1338	N/A	INTRINSIC
low complexity region	1380	1393	N/A	INTRINSIC
low complexity region	1415	1428	N/A	INTRINSIC
low complexity region	1432	1462	N/A	INTRINSIC
low complexity region	1474	1490	N/A	INTRINSIC
low complexity region	1552	1567	N/A	INTRINSIC
low complexity region	1636	1647	N/A	INTRINSIC
low complexity region	1689	1710	N/A	INTRINSIC
low complexity region	1744	1766	N/A	INTRINSIC
low complexity region	1846	1858	N/A	INTRINSIC
low complexity region	1971	1986	N/A	INTRINSIC
low complexity region	2024	2038	N/A	INTRINSIC
low complexity region	2041	2061	N/A	INTRINSIC
low complexity region	2129	2159	N/A	INTRINSIC
low complexity region	2186	2219	N/A	INTRINSIC
low complexity region	2311	2324	N/A	INTRINSIC
low complexity region	2389	2400	N/A	INTRINSIC
low complexity region	2430	2453	N/A	INTRINSIC
low complexity region	2474	2509	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000170500

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

96% (110/115)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an ortholog of the Drosophila melanogaster capicua gene, and is a member of the high mobility group (HMG)-box superfamily of transcriptional repressors. This protein contains a conserved HMG domain that is involved in DNA binding and nuclear localization, and a conserved C-terminus. Studies suggest that the N-terminal region of this protein interacts with Atxn1 (GeneID:6310), to form a transcription repressor complex, and in vitro studies suggest that polyglutamine-expansion of ATXN1 may alter the repressor activity of this complex. Mutations in this gene have been associated with olidogdendrogliomas (PMID:21817013). In addition, translocation events resulting in gene fusions of this gene with both DUX4 (GeneID:100288687) and FOXO4 (GeneID:4303) have been associated with round cell sarcomas. There are multiple pseudogenes of this gene found on chromosomes 1, 4, 6, 7, 16, 20, and the Y chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Feb 2015]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit partial postnatal lethality, decreased body size, and severe lung alveolarization defects. [provided by MGI curators]

Allele List at MGI

All alleles(61) : Targeted, other(4) Gene trapped(57)

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano2	A	G	6: 125,863,538	I391V	probably benign	Het
Apc	T	A	18: 34,298,594	L349M	probably damaging	Het
Atmin	A	G	8: 116,957,959	D786G	probably damaging	Het
Atp8a1	T	A	5: 67,762,586	D379V	possibly damaging	Het
Aurkb	A	G	11: 69,048,609	K173E	probably damaging	Het
Bak1	T	C	17: 27,022,536	I83V	possibly damaging	Het
Btbd17	A	C	11: 114,794,006	V69G	probably damaging	Het
Cacna1a	T	A	8: 84,601,767	Y1597*	probably null	Het
Camk2a	C	A	18: 60,955,624	Q167K	possibly damaging	Het
Capn1	A	T	19: 6,011,015	N253K	probably benign	Het
Ccer2	A	G	7: 28,756,503	E40G	probably benign	Het
Cdc42bpa	A	G	1: 180,144,565	T527A	probably damaging	Het
Cdkl2	T	C	5: 92,037,265	D89G	probably damaging	Het
Cep128	G	T	12: 91,296,253	R291S	probably damaging	Het
Chd4	A	G	6: 125,101,502	M203V	possibly damaging	Het
Chrna4	A	G	2: 181,037,493	S54P	probably damaging	Het
Cntn5	T	A	9: 10,144,209	I152L	possibly damaging	Het
Cntn6	A	G	6: 104,728,284	E154G	probably benign	Het
Col16a1	A	C	4: 130,062,090		probably benign	Het
Col4a3bp	T	C	13: 96,599,457	V175A	probably benign	Het
Cpvl	C	T	6: 53,931,933	E282K	probably benign	Het
Cyth2	T	C	7: 45,810,719	D183G	probably damaging	Het
Ddx47	A	T	6: 135,012,356	T48S	possibly damaging	Het
Dgkk	A	G	X: 6,928,512	D685G	probably benign	Het
Dis3l	C	T	9: 64,330,798	S29N	unknown	Het
Dlg5	T	C	14: 24,137,181	H1834R	possibly damaging	Het
Dnah10	T	C	5: 124,828,472	M4060T	possibly damaging	Het
Dock3	T	A	9: 106,993,544	N557I	possibly damaging	Het
Eprs	A	T	1: 185,373,076		probably benign	Het
Faim2	C	A	15: 99,524,700		probably null	Het
Faim2	T	G	15: 99,524,701	S72R	probably benign	Het
Fam84b	A	T	15: 60,823,629	D89E	probably benign	Het
Fanca	T	C	8: 123,268,972	T1364A	probably damaging	Het
Fance	T	C	17: 28,315,662		probably benign	Het
Farsb	A	T	1: 78,443,765	H496Q	possibly damaging	Het
Fryl	C	T	5: 73,090,679	E1032K	possibly damaging	Het
Galnt14	A	T	17: 73,507,813		probably benign	Het
Gba2	A	T	4: 43,568,619		probably benign	Het
Gjb4	C	A	4: 127,351,778	K123N	probably damaging	Het
Gmcl1	G	A	6: 86,732,998	T56I	probably benign	Het
Gtf2ird1	T	A	5: 134,383,902	E55V	probably damaging	Het
Gtpbp2	T	C	17: 46,161,154	V5A	probably benign	Het
Hnrnpr	A	G	4: 136,317,175		probably null	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Hsd3b3	T	C	3: 98,742,216	S264G	probably damaging	Het
Ints8	T	C	4: 11,227,152	M574V	probably benign	Het
Kif4-ps	G	A	12: 101,149,218		noncoding transcript	Het
Klhl14	A	T	18: 21,554,708	N552K	probably benign	Het
Klhl40	A	G	9: 121,780,733	E528G	probably damaging	Het
Lactb2	T	C	1: 13,647,400	E133G	probably damaging	Het
Lrrtm2	T	C	18: 35,214,257		probably null	Het
Mab21l2	T	A	3: 86,547,504	Y63F	probably benign	Het
Mbd1	T	A	18: 74,269,526	I33N	possibly damaging	Het
Mertk	G	A	2: 128,801,212	V844M	probably benign	Het
Mgea5	T	C	19: 45,771,945	E258G	probably benign	Het
Myh11	T	C	16: 14,226,584	T652A	possibly damaging	Het
Nlrp4a	C	A	7: 26,449,518	Y183*	probably null	Het
Noa1	T	A	5: 77,299,753	T558S	probably benign	Het
Nol11	A	T	11: 107,181,000	S256T	possibly damaging	Het
Nr1d1	G	T	11: 98,771,260	R183S	possibly damaging	Het
Nrg2	G	T	18: 36,052,895	Q264K	possibly damaging	Het
Nsd3	T	A	8: 25,698,866	F1027I	probably damaging	Het
Ntrk3	T	A	7: 78,461,099	I285F	probably damaging	Het
Obox8	T	C	7: 14,332,846	N91S	possibly damaging	Het
Orc5	C	T	5: 22,546,522	S63N	probably benign	Het
Osbpl6	C	T	2: 76,568,208	T412I	probably benign	Het
P2ry14	C	T	3: 59,115,142	C308Y	probably damaging	Het
Pacsin1	T	C	17: 27,707,064	F127L	probably damaging	Het
Pex11b	T	C	3: 96,643,835	L198P	possibly damaging	Het
Pla2g4e	A	T	2: 120,171,188	V660E	probably damaging	Het
Plxna4	C	A	6: 32,516,950	V244F	possibly damaging	Het
Polr3b	A	G	10: 84,714,369	Y981C	probably damaging	Het
Popdc2	T	A	16: 38,374,287	S357T	probably damaging	Het
Prr29	A	G	11: 106,376,333	H58R	probably damaging	Het
Pyy	T	A	11: 102,107,352	M1L	possibly damaging	Het
Rasd2	T	C	8: 75,221,928	S161P	possibly damaging	Het
Ryr3	C	T	2: 112,996,555		probably benign	Het
Sectm1a	G	A	11: 121,069,726	R88C	possibly damaging	Het
Serpinb13	C	T	1: 106,982,844	S66L	probably damaging	Het
Siglecf	A	T	7: 43,356,413	I465F	possibly damaging	Het
Sorl1	A	T	9: 42,004,051	M1294K	probably damaging	Het
Spam1	A	T	6: 24,796,662	H204L	probably benign	Het
Sspo	A	T	6: 48,473,534	N2586Y	possibly damaging	Het
Tbc1d4	A	G	14: 101,462,827		probably benign	Het
Tceanc2	A	T	4: 107,165,560	S77T	probably damaging	Het
Tedc2	A	G	17: 24,220,140		probably benign	Het
Tgm6	A	G	2: 130,137,394	D148G	probably benign	Het
Tgm6	A	T	2: 130,141,208	Q239L	probably benign	Het
Thsd7a	T	A	6: 12,337,314	T1235S	possibly damaging	Het
Thsd7a	T	A	6: 12,504,013	I381F	possibly damaging	Het
Tmc4	T	C	7: 3,671,271		probably null	Het
Tmem54	A	T	4: 129,110,911	E186D	possibly damaging	Het
Tpk1	A	T	6: 43,611,335	F32I	probably benign	Het
Trpc4ap	A	G	2: 155,672,997	I97T	probably benign	Het
Txlnb	A	G	10: 17,843,194	E591G	probably damaging	Het
Tyk2	C	T	9: 21,114,207	A741T	probably damaging	Het
Ubr4	G	A	4: 139,406,518	E742K	possibly damaging	Het
Uckl1	A	T	2: 181,574,868	S95T	possibly damaging	Het
Uevld	T	A	7: 46,937,986	D322V	probably damaging	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Vmn1r238	G	T	18: 3,123,300	T38K	probably damaging	Het
Vps8	T	A	16: 21,444,188		probably null	Het
Wdr60	T	C	12: 116,256,211	E37G	probably damaging	Het
Wdr83	T	C	8: 85,080,051		probably benign	Het
Zcchc6	G	A	13: 59,800,599	T636I	possibly damaging	Het
Zfp619	A	G	7: 39,534,135	T51A	probably benign	Het

Other mutations in Cic

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Cic	APN	7	25292124	missense	probably damaging	1.00
IGL01668:Cic	APN	7	25291204	missense	possibly damaging	0.47
IGL02229:Cic	APN	7	25290950	missense	probably damaging	0.96
IGL02506:Cic	APN	7	25290857	missense	probably benign
IGL02794:Cic	APN	7	25285644	missense	probably damaging	1.00
IGL03065:Cic	APN	7	25285821	splice site	probably benign
IGL03304:Cic	APN	7	25284849	missense	probably damaging	1.00
1mM(1):Cic	UTSW	7	25290789	splice site	probably benign
IGL03046:Cic	UTSW	7	25291075	missense	probably damaging	1.00
R0012:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0012:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0027:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0027:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0038:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0038:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0063:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0063:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0064:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0064:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0118:Cic	UTSW	7	25286034	missense	probably damaging	1.00
R0193:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0193:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0241:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0241:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0377:Cic	UTSW	7	25285799	missense	probably damaging	0.98
R0462:Cic	UTSW	7	25287140	missense	probably damaging	0.98
R0462:Cic	UTSW	7	25287141	missense	probably damaging	1.00
R0800:Cic	UTSW	7	25285237	missense	probably benign
R1253:Cic	UTSW	7	25290948	missense	probably damaging	1.00
R1458:Cic	UTSW	7	25279737	intron	probably benign
R1462:Cic	UTSW	7	25271607	missense	probably damaging	0.98
R1462:Cic	UTSW	7	25271607	missense	probably damaging	0.98
R1519:Cic	UTSW	7	25293810	critical splice acceptor site	probably null
R1586:Cic	UTSW	7	25285961	missense	probably damaging	1.00
R1824:Cic	UTSW	7	25288266	missense	probably damaging	1.00
R1908:Cic	UTSW	7	25286840	missense	probably damaging	1.00
R2045:Cic	UTSW	7	25271536	missense	possibly damaging	0.53
R2063:Cic	UTSW	7	25273451	missense	probably damaging	0.98
R2161:Cic	UTSW	7	25288134	unclassified	probably null
R2495:Cic	UTSW	7	25291776	splice site	probably benign
R2865:Cic	UTSW	7	25273221	missense	probably damaging	0.96
R3692:Cic	UTSW	7	25288913	nonsense	probably null
R3709:Cic	UTSW	7	25286981	missense	probably damaging	0.99
R3710:Cic	UTSW	7	25286981	missense	probably damaging	0.99
R3872:Cic	UTSW	7	25271699	missense	possibly damaging	0.92
R3946:Cic	UTSW	7	25272346	missense	possibly damaging	0.93
R4199:Cic	UTSW	7	25291670	frame shift	probably null
R4426:Cic	UTSW	7	25294008	utr 3 prime	probably benign
R4502:Cic	UTSW	7	25288467	missense	probably damaging	1.00
R4585:Cic	UTSW	7	25272778	missense	probably benign	0.33
R4586:Cic	UTSW	7	25272778	missense	probably benign	0.33
R4614:Cic	UTSW	7	25291670	frame shift	probably null
R4688:Cic	UTSW	7	25291670	frame shift	probably null
R4695:Cic	UTSW	7	25273588	missense	possibly damaging	0.72
R4696:Cic	UTSW	7	25288483	missense	probably benign
R4746:Cic	UTSW	7	25288480	missense	probably damaging	1.00
R4758:Cic	UTSW	7	25292211	missense	possibly damaging	0.62
R4767:Cic	UTSW	7	25271600	missense	possibly damaging	0.92
R4776:Cic	UTSW	7	25282883	missense	possibly damaging	0.95
R4820:Cic	UTSW	7	25271732	missense	possibly damaging	0.92
R4850:Cic	UTSW	7	25272902	missense	probably damaging	0.98
R4851:Cic	UTSW	7	25272902	missense	probably damaging	0.98
R4922:Cic	UTSW	7	25291670	small insertion	probably benign
R4989:Cic	UTSW	7	25287110	missense	probably damaging	1.00
R5131:Cic	UTSW	7	25291670	small insertion	probably benign
R5718:Cic	UTSW	7	25272778	missense	probably benign	0.33
R5801:Cic	UTSW	7	25271438	missense	possibly damaging	0.93
R5949:Cic	UTSW	7	25272305	missense	probably damaging	1.00
R6000:Cic	UTSW	7	25271998	missense	probably benign	0.33
R6246:Cic	UTSW	7	25271642	missense	probably damaging	1.00
R6283:Cic	UTSW	7	25286034	missense	probably damaging	1.00
R6364:Cic	UTSW	7	25272823	missense	possibly damaging	0.72
R6481:Cic	UTSW	7	25288281	missense	possibly damaging	0.56
R6919:Cic	UTSW	7	25271777	missense	probably benign	0.04
R6920:Cic	UTSW	7	25290682	missense	probably damaging	1.00
R6995:Cic	UTSW	7	25271311	missense	possibly damaging	0.53
R7002:Cic	UTSW	7	25272196	missense	probably damaging	0.99
R7113:Cic	UTSW	7	25273444	missense	probably benign	0.08
R7560:Cic	UTSW	7	25272853	missense	probably damaging	0.98
R7680:Cic	UTSW	7	25292431	missense	probably damaging	0.96
R7698:Cic	UTSW	7	25273172	missense	possibly damaging	0.72
R7746:Cic	UTSW	7	25288782	missense	probably damaging	1.00
R7841:Cic	UTSW	7	25285767	missense	probably damaging	1.00
R7879:Cic	UTSW	7	25285126	missense	probably benign	0.10
R7924:Cic	UTSW	7	25285767	missense	probably damaging	1.00
R7962:Cic	UTSW	7	25285126	missense	probably benign	0.10
R8056:Cic	UTSW	7	25290941	missense	possibly damaging	0.90
V7732:Cic	UTSW	7	25292245	missense	probably benign
Z1176:Cic	UTSW	7	25271019	missense	possibly damaging	0.91

Predicted Primers

PCR Primer
(F):5'- TCTTGCCTGGCCTATAGTGTAG -3'
(R):5'- TGAGGTCACTGTTCCAGTCTG -3'

Sequencing Primer
(F):5'- TTATCCAGCTGACTCCTG -3'
(R):5'- TCTGACTGCATGCAGAACTG -3'

Posted On

2015-10-08