Incidental Mutation 'R4664:Nlrp4a'
ID 353099
Institutional Source Beutler Lab
Gene Symbol Nlrp4a
Ensembl Gene ENSMUSG00000040601
Gene Name NLR family, pyrin domain containing 4A
Synonyms Nalp-eta, E330028A19Rik, Nalp4a
MMRRC Submission 041922-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R4664 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 26134538-26175100 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) C to A at 26148943 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Stop codon at position 183 (Y183*)
Ref Sequence ENSEMBL: ENSMUSP00000146044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068767] [ENSMUST00000119386] [ENSMUST00000146907]
AlphaFold Q8BU40
Predicted Effect probably null
Transcript: ENSMUST00000068767
AA Change: Y183*
SMART Domains Protein: ENSMUSP00000066841
Gene: ENSMUSG00000040601
AA Change: Y183*

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 4.9e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000119386
AA Change: Y183*
SMART Domains Protein: ENSMUSP00000112441
Gene: ENSMUSG00000040601
AA Change: Y183*

DomainStartEndE-ValueType
PYRIN 6 89 6.48e-34 SMART
Pfam:NACHT 148 317 1.3e-37 PFAM
Blast:LRR 634 661 4e-6 BLAST
low complexity region 666 677 N/A INTRINSIC
LRR 689 716 5.96e0 SMART
LRR 718 745 1.99e1 SMART
LRR 746 772 1.02e0 SMART
LRR 774 801 4.66e1 SMART
LRR 802 829 1.18e-2 SMART
LRR 831 858 2.2e-2 SMART
LRR 859 886 5.59e-4 SMART
LRR 888 915 9.41e0 SMART
LRR 916 943 8.94e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146534
Predicted Effect probably null
Transcript: ENSMUST00000146907
AA Change: Y183*
Meta Mutation Damage Score 0.9699 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (110/115)
Allele List at MGI
Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 A G 6: 125,840,501 (GRCm39) I391V probably benign Het
Apc T A 18: 34,431,647 (GRCm39) L349M probably damaging Het
Atmin A G 8: 117,684,698 (GRCm39) D786G probably damaging Het
Atp8a1 T A 5: 67,919,929 (GRCm39) D379V possibly damaging Het
Aurkb A G 11: 68,939,435 (GRCm39) K173E probably damaging Het
Bak1 T C 17: 27,241,510 (GRCm39) I83V possibly damaging Het
Btbd17 A C 11: 114,684,832 (GRCm39) V69G probably damaging Het
Cacna1a T A 8: 85,328,396 (GRCm39) Y1597* probably null Het
Camk2a C A 18: 61,088,696 (GRCm39) Q167K possibly damaging Het
Capn1 A T 19: 6,061,045 (GRCm39) N253K probably benign Het
Ccer2 A G 7: 28,455,928 (GRCm39) E40G probably benign Het
Cdc42bpa A G 1: 179,972,130 (GRCm39) T527A probably damaging Het
Cdkl2 T C 5: 92,185,124 (GRCm39) D89G probably damaging Het
Cep128 G T 12: 91,263,027 (GRCm39) R291S probably damaging Het
Cert1 T C 13: 96,735,965 (GRCm39) V175A probably benign Het
Chd4 A G 6: 125,078,465 (GRCm39) M203V possibly damaging Het
Chrna4 A G 2: 180,679,286 (GRCm39) S54P probably damaging Het
Cic TGTTGCCCTC T 7: 24,990,099 (GRCm39) probably benign Het
Cntn5 T A 9: 10,144,214 (GRCm39) I152L possibly damaging Het
Cntn6 A G 6: 104,705,245 (GRCm39) E154G probably benign Het
Col16a1 A C 4: 129,955,883 (GRCm39) probably benign Het
Cpvl C T 6: 53,908,918 (GRCm39) E282K probably benign Het
Cyth2 T C 7: 45,460,143 (GRCm39) D183G probably damaging Het
Ddx47 A T 6: 134,989,319 (GRCm39) T48S possibly damaging Het
Dgkk A G X: 6,794,751 (GRCm39) D685G probably benign Het
Dis3l C T 9: 64,238,080 (GRCm39) S29N unknown Het
Dlg5 T C 14: 24,187,249 (GRCm39) H1834R possibly damaging Het
Dnah10 T C 5: 124,905,536 (GRCm39) M4060T possibly damaging Het
Dock3 T A 9: 106,870,743 (GRCm39) N557I possibly damaging Het
Dync2i1 T C 12: 116,219,831 (GRCm39) E37G probably damaging Het
Eprs1 A T 1: 185,105,273 (GRCm39) probably benign Het
Faim2 C A 15: 99,422,581 (GRCm39) probably null Het
Faim2 T G 15: 99,422,582 (GRCm39) S72R probably benign Het
Fanca T C 8: 123,995,711 (GRCm39) T1364A probably damaging Het
Fance T C 17: 28,534,636 (GRCm39) probably benign Het
Farsb A T 1: 78,420,402 (GRCm39) H496Q possibly damaging Het
Fryl C T 5: 73,248,022 (GRCm39) E1032K possibly damaging Het
Galnt14 A T 17: 73,814,808 (GRCm39) probably benign Het
Gba2 A T 4: 43,568,619 (GRCm39) probably benign Het
Gjb4 C A 4: 127,245,571 (GRCm39) K123N probably damaging Het
Gmcl1 G A 6: 86,709,980 (GRCm39) T56I probably benign Het
Gtf2ird1 T A 5: 134,412,756 (GRCm39) E55V probably damaging Het
Gtpbp2 T C 17: 46,472,080 (GRCm39) V5A probably benign Het
Hnrnpr A G 4: 136,044,486 (GRCm39) probably benign Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Hsd3b3 T C 3: 98,649,532 (GRCm39) S264G probably damaging Het
Ints8 T C 4: 11,227,152 (GRCm39) M574V probably benign Het
Kif4-ps G A 12: 101,115,477 (GRCm39) noncoding transcript Het
Klhl14 A T 18: 21,687,765 (GRCm39) N552K probably benign Het
Klhl40 A G 9: 121,609,799 (GRCm39) E528G probably damaging Het
Lactb2 T C 1: 13,717,624 (GRCm39) E133G probably damaging Het
Lratd2 A T 15: 60,695,478 (GRCm39) D89E probably benign Het
Lrrtm2 T C 18: 35,347,310 (GRCm39) probably null Het
Mab21l2 T A 3: 86,454,811 (GRCm39) Y63F probably benign Het
Mbd1 T A 18: 74,402,597 (GRCm39) I33N possibly damaging Het
Mertk G A 2: 128,643,132 (GRCm39) V844M probably benign Het
Myh11 T C 16: 14,044,448 (GRCm39) T652A possibly damaging Het
Noa1 T A 5: 77,447,600 (GRCm39) T558S probably benign Het
Nol11 A T 11: 107,071,826 (GRCm39) S256T possibly damaging Het
Nr1d1 G T 11: 98,662,086 (GRCm39) R183S possibly damaging Het
Nrg2 G T 18: 36,185,948 (GRCm39) Q264K possibly damaging Het
Nsd3 T A 8: 26,188,894 (GRCm39) F1027I probably damaging Het
Ntrk3 T A 7: 78,110,847 (GRCm39) I285F probably damaging Het
Obox8 T C 7: 14,066,771 (GRCm39) N91S possibly damaging Het
Oga T C 19: 45,760,384 (GRCm39) E258G probably benign Het
Orc5 C T 5: 22,751,520 (GRCm39) S63N probably benign Het
Osbpl6 C T 2: 76,398,552 (GRCm39) T412I probably benign Het
P2ry14 C T 3: 59,022,563 (GRCm39) C308Y probably damaging Het
Pacsin1 T C 17: 27,926,038 (GRCm39) F127L probably damaging Het
Pex11b T C 3: 96,551,151 (GRCm39) L198P possibly damaging Het
Pla2g4e A T 2: 120,001,669 (GRCm39) V660E probably damaging Het
Plxna4 C A 6: 32,493,885 (GRCm39) V244F possibly damaging Het
Polr3b A G 10: 84,550,233 (GRCm39) Y981C probably damaging Het
Popdc2 T A 16: 38,194,649 (GRCm39) S357T probably damaging Het
Prr29 A G 11: 106,267,159 (GRCm39) H58R probably damaging Het
Pyy T A 11: 101,998,178 (GRCm39) M1L possibly damaging Het
Rasd2 T C 8: 75,948,556 (GRCm39) S161P possibly damaging Het
Ryr3 C T 2: 112,826,900 (GRCm39) probably benign Het
Sectm1a G A 11: 120,960,552 (GRCm39) R88C possibly damaging Het
Serpinb13 C T 1: 106,910,574 (GRCm39) S66L probably damaging Het
Siglecf A T 7: 43,005,837 (GRCm39) I465F possibly damaging Het
Sorl1 A T 9: 41,915,347 (GRCm39) M1294K probably damaging Het
Spam1 A T 6: 24,796,661 (GRCm39) H204L probably benign Het
Sspo A T 6: 48,450,468 (GRCm39) N2586Y possibly damaging Het
Tbc1d4 A G 14: 101,700,263 (GRCm39) probably benign Het
Tceanc2 A T 4: 107,022,757 (GRCm39) S77T probably damaging Het
Tedc2 A G 17: 24,439,114 (GRCm39) probably benign Het
Tgm6 A G 2: 129,979,314 (GRCm39) D148G probably benign Het
Tgm6 A T 2: 129,983,128 (GRCm39) Q239L probably benign Het
Thsd7a T A 6: 12,337,313 (GRCm39) T1235S possibly damaging Het
Thsd7a T A 6: 12,504,012 (GRCm39) I381F possibly damaging Het
Tmc4 T C 7: 3,674,270 (GRCm39) probably null Het
Tmem54 A T 4: 129,004,704 (GRCm39) E186D possibly damaging Het
Tpk1 A T 6: 43,588,269 (GRCm39) F32I probably benign Het
Trpc4ap A G 2: 155,514,917 (GRCm39) I97T probably benign Het
Tut7 G A 13: 59,948,413 (GRCm39) T636I possibly damaging Het
Txlnb A G 10: 17,718,942 (GRCm39) E591G probably damaging Het
Tyk2 C T 9: 21,025,503 (GRCm39) A741T probably damaging Het
Ubr4 G A 4: 139,133,829 (GRCm39) E742K possibly damaging Het
Uckl1 A T 2: 181,216,661 (GRCm39) S95T possibly damaging Het
Uevld T A 7: 46,587,734 (GRCm39) D322V probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,139,706 (GRCm39) probably benign Het
Vmn1r238 G T 18: 3,123,300 (GRCm39) T38K probably damaging Het
Vps8 T A 16: 21,262,938 (GRCm39) probably null Het
Wdr83 T C 8: 85,806,680 (GRCm39) probably benign Het
Zfp619 A G 7: 39,183,559 (GRCm39) T51A probably benign Het
Other mutations in Nlrp4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00487:Nlrp4a APN 7 26,149,410 (GRCm39) missense possibly damaging 0.51
IGL00972:Nlrp4a APN 7 26,156,473 (GRCm39) missense probably benign
IGL01081:Nlrp4a APN 7 26,149,254 (GRCm39) missense probably benign 0.06
IGL01788:Nlrp4a APN 7 26,153,492 (GRCm39) missense probably benign 0.17
IGL02001:Nlrp4a APN 7 26,149,394 (GRCm39) missense probably benign 0.01
IGL02070:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02175:Nlrp4a APN 7 26,174,522 (GRCm39) missense probably damaging 1.00
IGL02193:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02193:Nlrp4a APN 7 26,159,117 (GRCm39) missense probably damaging 1.00
IGL02197:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02200:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02202:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02207:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02237:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02240:Nlrp4a APN 7 26,148,703 (GRCm39) missense possibly damaging 0.77
IGL02658:Nlrp4a APN 7 26,149,138 (GRCm39) missense probably benign 0.43
IGL02743:Nlrp4a APN 7 26,159,240 (GRCm39) splice site probably benign
IGL02960:Nlrp4a APN 7 26,149,155 (GRCm39) missense probably benign 0.05
IGL03064:Nlrp4a APN 7 26,148,934 (GRCm39) missense probably benign 0.23
IGL03276:Nlrp4a APN 7 26,163,615 (GRCm39) missense probably damaging 1.00
BB002:Nlrp4a UTSW 7 26,150,011 (GRCm39) missense probably benign 0.10
BB012:Nlrp4a UTSW 7 26,150,011 (GRCm39) missense probably benign 0.10
D3080:Nlrp4a UTSW 7 26,143,766 (GRCm39) missense probably benign 0.22
P0019:Nlrp4a UTSW 7 26,149,062 (GRCm39) missense probably damaging 1.00
R0020:Nlrp4a UTSW 7 26,149,797 (GRCm39) missense probably damaging 1.00
R0240:Nlrp4a UTSW 7 26,161,941 (GRCm39) missense probably benign 0.00
R0240:Nlrp4a UTSW 7 26,161,941 (GRCm39) missense probably benign 0.00
R0372:Nlrp4a UTSW 7 26,148,657 (GRCm39) splice site probably benign
R0466:Nlrp4a UTSW 7 26,162,045 (GRCm39) splice site probably benign
R0544:Nlrp4a UTSW 7 26,156,555 (GRCm39) missense probably benign 0.00
R1006:Nlrp4a UTSW 7 26,152,892 (GRCm39) missense probably benign 0.30
R1072:Nlrp4a UTSW 7 26,143,860 (GRCm39) missense probably damaging 1.00
R1432:Nlrp4a UTSW 7 26,163,622 (GRCm39) frame shift probably null
R1655:Nlrp4a UTSW 7 26,149,076 (GRCm39) missense possibly damaging 0.56
R1696:Nlrp4a UTSW 7 26,149,959 (GRCm39) missense probably damaging 1.00
R2041:Nlrp4a UTSW 7 26,149,611 (GRCm39) missense probably damaging 0.97
R2091:Nlrp4a UTSW 7 26,149,578 (GRCm39) missense probably damaging 1.00
R2163:Nlrp4a UTSW 7 26,152,822 (GRCm39) missense probably benign 0.00
R2174:Nlrp4a UTSW 7 26,148,849 (GRCm39) missense probably damaging 1.00
R2319:Nlrp4a UTSW 7 26,149,319 (GRCm39) missense probably benign 0.10
R2358:Nlrp4a UTSW 7 26,163,623 (GRCm39) missense probably benign 0.03
R2680:Nlrp4a UTSW 7 26,148,655 (GRCm39) splice site probably null
R3812:Nlrp4a UTSW 7 26,149,118 (GRCm39) missense probably benign
R4114:Nlrp4a UTSW 7 26,149,365 (GRCm39) missense probably damaging 1.00
R4676:Nlrp4a UTSW 7 26,149,654 (GRCm39) missense probably damaging 1.00
R4708:Nlrp4a UTSW 7 26,163,533 (GRCm39) missense probably benign 0.00
R4728:Nlrp4a UTSW 7 26,174,515 (GRCm39) missense probably benign 0.24
R4815:Nlrp4a UTSW 7 26,150,233 (GRCm39) missense probably benign 0.00
R4831:Nlrp4a UTSW 7 26,149,844 (GRCm39) missense possibly damaging 0.92
R5007:Nlrp4a UTSW 7 26,161,905 (GRCm39) missense probably damaging 0.99
R5253:Nlrp4a UTSW 7 26,149,917 (GRCm39) missense probably benign 0.00
R5262:Nlrp4a UTSW 7 26,159,236 (GRCm39) critical splice donor site probably null
R5441:Nlrp4a UTSW 7 26,153,578 (GRCm39) missense probably damaging 1.00
R5639:Nlrp4a UTSW 7 26,156,455 (GRCm39) missense probably benign 0.02
R5641:Nlrp4a UTSW 7 26,149,589 (GRCm39) missense probably damaging 1.00
R5771:Nlrp4a UTSW 7 26,152,814 (GRCm39) missense probably damaging 1.00
R6312:Nlrp4a UTSW 7 26,148,821 (GRCm39) missense probably benign 0.11
R7131:Nlrp4a UTSW 7 26,149,258 (GRCm39) missense probably benign 0.21
R7149:Nlrp4a UTSW 7 26,149,863 (GRCm39) missense probably benign 0.00
R7348:Nlrp4a UTSW 7 26,143,698 (GRCm39) missense probably damaging 1.00
R7384:Nlrp4a UTSW 7 26,148,963 (GRCm39) missense not run
R7548:Nlrp4a UTSW 7 26,149,604 (GRCm39) missense probably damaging 1.00
R7566:Nlrp4a UTSW 7 26,148,670 (GRCm39) critical splice acceptor site probably null
R7646:Nlrp4a UTSW 7 26,148,987 (GRCm39) missense probably damaging 0.96
R7692:Nlrp4a UTSW 7 26,148,690 (GRCm39) missense probably benign 0.01
R7902:Nlrp4a UTSW 7 26,149,482 (GRCm39) missense possibly damaging 0.65
R7925:Nlrp4a UTSW 7 26,150,011 (GRCm39) missense probably benign 0.10
R7937:Nlrp4a UTSW 7 26,163,571 (GRCm39) missense probably benign 0.00
R7992:Nlrp4a UTSW 7 26,150,070 (GRCm39) missense possibly damaging 0.51
R8205:Nlrp4a UTSW 7 26,150,219 (GRCm39) missense probably benign
R8477:Nlrp4a UTSW 7 26,159,219 (GRCm39) missense probably benign
R8704:Nlrp4a UTSW 7 26,156,563 (GRCm39) missense probably benign 0.02
R8791:Nlrp4a UTSW 7 26,143,561 (GRCm39) splice site probably benign
R9220:Nlrp4a UTSW 7 26,149,523 (GRCm39) missense probably damaging 0.97
R9332:Nlrp4a UTSW 7 26,159,077 (GRCm39) missense probably damaging 0.99
T0975:Nlrp4a UTSW 7 26,149,062 (GRCm39) missense probably damaging 1.00
X0022:Nlrp4a UTSW 7 26,143,767 (GRCm39) missense probably damaging 0.99
Z1088:Nlrp4a UTSW 7 26,153,588 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGACAGTTCCAGAGCATTCAC -3'
(R):5'- ACAGCTCTGATTCCCATTTGAAC -3'

Sequencing Primer
(F):5'- GACAGTTCCAGAGCATTCACTATTAG -3'
(R):5'- GCTCTGATTCCCATTTGAACAAATC -3'
Posted On 2015-10-08