Incidental Mutation 'R4664:Sorl1'
ID 353113
Institutional Source Beutler Lab
Gene Symbol Sorl1
Ensembl Gene ENSMUSG00000049313
Gene Name sortilin-related receptor, LDLR class A repeats-containing
Synonyms Sorla, mSorLA, LR11, 2900010L19Rik
MMRRC Submission 041922-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.319) question?
Stock # R4664 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 41876016-42035593 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 41915347 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 1294 (M1294K)
Ref Sequence ENSEMBL: ENSMUSP00000058613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060989]
AlphaFold O88307
Predicted Effect probably damaging
Transcript: ENSMUST00000060989
AA Change: M1294K

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: M1294K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VPS10 124 757 N/A SMART
LY 780 822 9.33e-6 SMART
LY 824 866 2.38e-12 SMART
LY 867 912 1.87e-5 SMART
LY 913 953 1.08e-10 SMART
LY 954 993 5.43e0 SMART
EGF_like 1020 1072 2.8e1 SMART
LDLa 1077 1114 1.76e-14 SMART
LDLa 1116 1155 5.34e-14 SMART
LDLa 1157 1194 1.67e-15 SMART
EGF_like 1198 1236 4.93e1 SMART
LDLa 1198 1237 3.83e-15 SMART
LDLa 1238 1273 1.99e-13 SMART
LDLa 1274 1317 2.53e-6 SMART
LDLa 1324 1361 4.34e-14 SMART
LDLa 1367 1405 1.14e-13 SMART
LDLa 1418 1455 3.34e-15 SMART
LDLa 1470 1508 1.09e-10 SMART
LDLa 1513 1551 1.09e-10 SMART
FN3 1555 1638 4.19e-4 SMART
FN3 1651 1732 7.23e-8 SMART
FN3 1747 1830 4.8e0 SMART
FN3 1842 1920 3e1 SMART
FN3 1933 2016 6.01e-5 SMART
FN3 2025 2107 2.03e-2 SMART
transmembrane domain 2137 2159 N/A INTRINSIC
low complexity region 2188 2199 N/A INTRINSIC
Meta Mutation Damage Score 0.2658 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (110/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 A G 6: 125,840,501 (GRCm39) I391V probably benign Het
Apc T A 18: 34,431,647 (GRCm39) L349M probably damaging Het
Atmin A G 8: 117,684,698 (GRCm39) D786G probably damaging Het
Atp8a1 T A 5: 67,919,929 (GRCm39) D379V possibly damaging Het
Aurkb A G 11: 68,939,435 (GRCm39) K173E probably damaging Het
Bak1 T C 17: 27,241,510 (GRCm39) I83V possibly damaging Het
Btbd17 A C 11: 114,684,832 (GRCm39) V69G probably damaging Het
Cacna1a T A 8: 85,328,396 (GRCm39) Y1597* probably null Het
Camk2a C A 18: 61,088,696 (GRCm39) Q167K possibly damaging Het
Capn1 A T 19: 6,061,045 (GRCm39) N253K probably benign Het
Ccer2 A G 7: 28,455,928 (GRCm39) E40G probably benign Het
Cdc42bpa A G 1: 179,972,130 (GRCm39) T527A probably damaging Het
Cdkl2 T C 5: 92,185,124 (GRCm39) D89G probably damaging Het
Cep128 G T 12: 91,263,027 (GRCm39) R291S probably damaging Het
Cert1 T C 13: 96,735,965 (GRCm39) V175A probably benign Het
Chd4 A G 6: 125,078,465 (GRCm39) M203V possibly damaging Het
Chrna4 A G 2: 180,679,286 (GRCm39) S54P probably damaging Het
Cic TGTTGCCCTC T 7: 24,990,099 (GRCm39) probably benign Het
Cntn5 T A 9: 10,144,214 (GRCm39) I152L possibly damaging Het
Cntn6 A G 6: 104,705,245 (GRCm39) E154G probably benign Het
Col16a1 A C 4: 129,955,883 (GRCm39) probably benign Het
Cpvl C T 6: 53,908,918 (GRCm39) E282K probably benign Het
Cyth2 T C 7: 45,460,143 (GRCm39) D183G probably damaging Het
Ddx47 A T 6: 134,989,319 (GRCm39) T48S possibly damaging Het
Dgkk A G X: 6,794,751 (GRCm39) D685G probably benign Het
Dis3l C T 9: 64,238,080 (GRCm39) S29N unknown Het
Dlg5 T C 14: 24,187,249 (GRCm39) H1834R possibly damaging Het
Dnah10 T C 5: 124,905,536 (GRCm39) M4060T possibly damaging Het
Dock3 T A 9: 106,870,743 (GRCm39) N557I possibly damaging Het
Dync2i1 T C 12: 116,219,831 (GRCm39) E37G probably damaging Het
Eprs1 A T 1: 185,105,273 (GRCm39) probably benign Het
Faim2 C A 15: 99,422,581 (GRCm39) probably null Het
Faim2 T G 15: 99,422,582 (GRCm39) S72R probably benign Het
Fanca T C 8: 123,995,711 (GRCm39) T1364A probably damaging Het
Fance T C 17: 28,534,636 (GRCm39) probably benign Het
Farsb A T 1: 78,420,402 (GRCm39) H496Q possibly damaging Het
Fryl C T 5: 73,248,022 (GRCm39) E1032K possibly damaging Het
Galnt14 A T 17: 73,814,808 (GRCm39) probably benign Het
Gba2 A T 4: 43,568,619 (GRCm39) probably benign Het
Gjb4 C A 4: 127,245,571 (GRCm39) K123N probably damaging Het
Gmcl1 G A 6: 86,709,980 (GRCm39) T56I probably benign Het
Gtf2ird1 T A 5: 134,412,756 (GRCm39) E55V probably damaging Het
Gtpbp2 T C 17: 46,472,080 (GRCm39) V5A probably benign Het
Hnrnpr A G 4: 136,044,486 (GRCm39) probably benign Het
Homer3 G A 8: 70,742,793 (GRCm39) probably null Het
Hsd3b3 T C 3: 98,649,532 (GRCm39) S264G probably damaging Het
Ints8 T C 4: 11,227,152 (GRCm39) M574V probably benign Het
Kif4-ps G A 12: 101,115,477 (GRCm39) noncoding transcript Het
Klhl14 A T 18: 21,687,765 (GRCm39) N552K probably benign Het
Klhl40 A G 9: 121,609,799 (GRCm39) E528G probably damaging Het
Lactb2 T C 1: 13,717,624 (GRCm39) E133G probably damaging Het
Lratd2 A T 15: 60,695,478 (GRCm39) D89E probably benign Het
Lrrtm2 T C 18: 35,347,310 (GRCm39) probably null Het
Mab21l2 T A 3: 86,454,811 (GRCm39) Y63F probably benign Het
Mbd1 T A 18: 74,402,597 (GRCm39) I33N possibly damaging Het
Mertk G A 2: 128,643,132 (GRCm39) V844M probably benign Het
Myh11 T C 16: 14,044,448 (GRCm39) T652A possibly damaging Het
Nlrp4a C A 7: 26,148,943 (GRCm39) Y183* probably null Het
Noa1 T A 5: 77,447,600 (GRCm39) T558S probably benign Het
Nol11 A T 11: 107,071,826 (GRCm39) S256T possibly damaging Het
Nr1d1 G T 11: 98,662,086 (GRCm39) R183S possibly damaging Het
Nrg2 G T 18: 36,185,948 (GRCm39) Q264K possibly damaging Het
Nsd3 T A 8: 26,188,894 (GRCm39) F1027I probably damaging Het
Ntrk3 T A 7: 78,110,847 (GRCm39) I285F probably damaging Het
Obox8 T C 7: 14,066,771 (GRCm39) N91S possibly damaging Het
Oga T C 19: 45,760,384 (GRCm39) E258G probably benign Het
Orc5 C T 5: 22,751,520 (GRCm39) S63N probably benign Het
Osbpl6 C T 2: 76,398,552 (GRCm39) T412I probably benign Het
P2ry14 C T 3: 59,022,563 (GRCm39) C308Y probably damaging Het
Pacsin1 T C 17: 27,926,038 (GRCm39) F127L probably damaging Het
Pex11b T C 3: 96,551,151 (GRCm39) L198P possibly damaging Het
Pla2g4e A T 2: 120,001,669 (GRCm39) V660E probably damaging Het
Plxna4 C A 6: 32,493,885 (GRCm39) V244F possibly damaging Het
Polr3b A G 10: 84,550,233 (GRCm39) Y981C probably damaging Het
Popdc2 T A 16: 38,194,649 (GRCm39) S357T probably damaging Het
Prr29 A G 11: 106,267,159 (GRCm39) H58R probably damaging Het
Pyy T A 11: 101,998,178 (GRCm39) M1L possibly damaging Het
Rasd2 T C 8: 75,948,556 (GRCm39) S161P possibly damaging Het
Ryr3 C T 2: 112,826,900 (GRCm39) probably benign Het
Sectm1a G A 11: 120,960,552 (GRCm39) R88C possibly damaging Het
Serpinb13 C T 1: 106,910,574 (GRCm39) S66L probably damaging Het
Siglecf A T 7: 43,005,837 (GRCm39) I465F possibly damaging Het
Spam1 A T 6: 24,796,661 (GRCm39) H204L probably benign Het
Sspo A T 6: 48,450,468 (GRCm39) N2586Y possibly damaging Het
Tbc1d4 A G 14: 101,700,263 (GRCm39) probably benign Het
Tceanc2 A T 4: 107,022,757 (GRCm39) S77T probably damaging Het
Tedc2 A G 17: 24,439,114 (GRCm39) probably benign Het
Tgm6 A G 2: 129,979,314 (GRCm39) D148G probably benign Het
Tgm6 A T 2: 129,983,128 (GRCm39) Q239L probably benign Het
Thsd7a T A 6: 12,337,313 (GRCm39) T1235S possibly damaging Het
Thsd7a T A 6: 12,504,012 (GRCm39) I381F possibly damaging Het
Tmc4 T C 7: 3,674,270 (GRCm39) probably null Het
Tmem54 A T 4: 129,004,704 (GRCm39) E186D possibly damaging Het
Tpk1 A T 6: 43,588,269 (GRCm39) F32I probably benign Het
Trpc4ap A G 2: 155,514,917 (GRCm39) I97T probably benign Het
Tut7 G A 13: 59,948,413 (GRCm39) T636I possibly damaging Het
Txlnb A G 10: 17,718,942 (GRCm39) E591G probably damaging Het
Tyk2 C T 9: 21,025,503 (GRCm39) A741T probably damaging Het
Ubr4 G A 4: 139,133,829 (GRCm39) E742K possibly damaging Het
Uckl1 A T 2: 181,216,661 (GRCm39) S95T possibly damaging Het
Uevld T A 7: 46,587,734 (GRCm39) D322V probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,139,706 (GRCm39) probably benign Het
Vmn1r238 G T 18: 3,123,300 (GRCm39) T38K probably damaging Het
Vps8 T A 16: 21,262,938 (GRCm39) probably null Het
Wdr83 T C 8: 85,806,680 (GRCm39) probably benign Het
Zfp619 A G 7: 39,183,559 (GRCm39) T51A probably benign Het
Other mutations in Sorl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Sorl1 APN 9 41,885,390 (GRCm39) missense probably damaging 1.00
IGL01303:Sorl1 APN 9 41,935,774 (GRCm39) splice site probably benign
IGL01545:Sorl1 APN 9 41,955,252 (GRCm39) missense probably damaging 1.00
IGL01629:Sorl1 APN 9 41,968,565 (GRCm39) critical splice donor site probably null
IGL01670:Sorl1 APN 9 41,912,788 (GRCm39) missense possibly damaging 0.81
IGL01684:Sorl1 APN 9 41,892,007 (GRCm39) missense probably damaging 0.96
IGL02154:Sorl1 APN 9 41,915,330 (GRCm39) missense probably benign
IGL02215:Sorl1 APN 9 41,929,478 (GRCm39) missense probably damaging 0.97
IGL02427:Sorl1 APN 9 41,952,986 (GRCm39) missense probably damaging 1.00
IGL02590:Sorl1 APN 9 41,957,857 (GRCm39) missense probably benign 0.01
IGL02794:Sorl1 APN 9 41,975,070 (GRCm39) missense probably damaging 0.98
IGL02797:Sorl1 APN 9 41,948,355 (GRCm39) missense probably damaging 0.99
IGL02987:Sorl1 APN 9 41,952,349 (GRCm39) missense probably damaging 1.00
IGL03005:Sorl1 APN 9 41,968,621 (GRCm39) missense probably damaging 1.00
IGL03069:Sorl1 APN 9 41,902,722 (GRCm39) missense probably benign
IGL03288:Sorl1 APN 9 41,944,858 (GRCm39) splice site probably benign
N/A - 287:Sorl1 UTSW 9 41,952,892 (GRCm39) nonsense probably null
PIT4151001:Sorl1 UTSW 9 41,879,918 (GRCm39) missense probably damaging 1.00
R0117:Sorl1 UTSW 9 41,944,873 (GRCm39) missense probably benign 0.10
R0173:Sorl1 UTSW 9 41,979,229 (GRCm39) missense probably damaging 0.99
R0318:Sorl1 UTSW 9 41,993,250 (GRCm39) missense probably damaging 1.00
R0385:Sorl1 UTSW 9 41,943,205 (GRCm39) missense probably damaging 0.99
R0448:Sorl1 UTSW 9 41,915,384 (GRCm39) missense probably damaging 1.00
R0492:Sorl1 UTSW 9 41,902,667 (GRCm39) missense probably null 0.00
R0512:Sorl1 UTSW 9 41,979,128 (GRCm39) missense probably benign 0.01
R0587:Sorl1 UTSW 9 41,895,802 (GRCm39) missense probably damaging 1.00
R0600:Sorl1 UTSW 9 41,955,196 (GRCm39) splice site probably benign
R0831:Sorl1 UTSW 9 41,982,365 (GRCm39) splice site probably benign
R0924:Sorl1 UTSW 9 41,919,470 (GRCm39) splice site probably benign
R1013:Sorl1 UTSW 9 41,913,855 (GRCm39) missense probably benign 0.00
R1053:Sorl1 UTSW 9 41,902,752 (GRCm39) missense probably benign
R1077:Sorl1 UTSW 9 41,925,786 (GRCm39) missense probably damaging 1.00
R1326:Sorl1 UTSW 9 41,943,092 (GRCm39) missense probably benign 0.14
R1348:Sorl1 UTSW 9 41,911,708 (GRCm39) splice site probably null
R1498:Sorl1 UTSW 9 41,952,369 (GRCm39) missense probably damaging 1.00
R1671:Sorl1 UTSW 9 41,885,296 (GRCm39) missense probably damaging 1.00
R1713:Sorl1 UTSW 9 41,907,538 (GRCm39) missense probably benign 0.06
R1738:Sorl1 UTSW 9 42,001,261 (GRCm39) missense probably benign 0.33
R1779:Sorl1 UTSW 9 41,902,778 (GRCm39) critical splice acceptor site probably null
R1871:Sorl1 UTSW 9 41,881,021 (GRCm39) nonsense probably null
R1912:Sorl1 UTSW 9 41,993,246 (GRCm39) missense probably damaging 1.00
R1952:Sorl1 UTSW 9 41,957,920 (GRCm39) missense probably benign
R2071:Sorl1 UTSW 9 41,890,753 (GRCm39) missense possibly damaging 0.71
R2153:Sorl1 UTSW 9 41,895,788 (GRCm39) missense probably benign 0.01
R2417:Sorl1 UTSW 9 41,892,007 (GRCm39) missense probably damaging 0.96
R2429:Sorl1 UTSW 9 41,948,366 (GRCm39) missense probably damaging 1.00
R2866:Sorl1 UTSW 9 41,881,077 (GRCm39) missense probably benign
R3815:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3816:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3817:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3819:Sorl1 UTSW 9 41,975,345 (GRCm39) missense possibly damaging 0.71
R3890:Sorl1 UTSW 9 41,915,401 (GRCm39) missense probably damaging 1.00
R3941:Sorl1 UTSW 9 41,900,764 (GRCm39) critical splice acceptor site probably null
R4409:Sorl1 UTSW 9 41,946,744 (GRCm39) missense probably damaging 0.99
R4410:Sorl1 UTSW 9 41,915,288 (GRCm39) nonsense probably null
R4610:Sorl1 UTSW 9 41,943,210 (GRCm39) missense possibly damaging 0.65
R4666:Sorl1 UTSW 9 41,915,347 (GRCm39) missense probably damaging 0.97
R4668:Sorl1 UTSW 9 41,895,804 (GRCm39) missense probably damaging 1.00
R4823:Sorl1 UTSW 9 41,903,617 (GRCm39) missense probably damaging 1.00
R4874:Sorl1 UTSW 9 41,975,048 (GRCm39) missense probably damaging 0.99
R4898:Sorl1 UTSW 9 41,952,935 (GRCm39) missense probably damaging 1.00
R4922:Sorl1 UTSW 9 41,925,746 (GRCm39) splice site probably null
R4976:Sorl1 UTSW 9 41,894,299 (GRCm39) missense probably benign 0.00
R4984:Sorl1 UTSW 9 41,902,638 (GRCm39) missense probably damaging 1.00
R5046:Sorl1 UTSW 9 41,907,590 (GRCm39) missense probably benign
R5070:Sorl1 UTSW 9 41,943,114 (GRCm39) missense possibly damaging 0.82
R5084:Sorl1 UTSW 9 41,887,673 (GRCm39) missense probably benign 0.01
R5202:Sorl1 UTSW 9 41,944,879 (GRCm39) missense probably benign 0.00
R5265:Sorl1 UTSW 9 42,017,812 (GRCm39) missense possibly damaging 0.80
R5275:Sorl1 UTSW 9 41,942,198 (GRCm39) missense probably benign 0.33
R5368:Sorl1 UTSW 9 41,890,686 (GRCm39) missense probably benign 0.00
R5385:Sorl1 UTSW 9 41,968,580 (GRCm39) missense possibly damaging 0.83
R5386:Sorl1 UTSW 9 41,968,580 (GRCm39) missense possibly damaging 0.83
R5416:Sorl1 UTSW 9 41,913,932 (GRCm39) nonsense probably null
R5518:Sorl1 UTSW 9 41,948,508 (GRCm39) missense possibly damaging 0.92
R5545:Sorl1 UTSW 9 41,902,921 (GRCm39) missense probably benign 0.08
R5864:Sorl1 UTSW 9 42,003,669 (GRCm39) missense probably damaging 1.00
R5865:Sorl1 UTSW 9 41,894,330 (GRCm39) missense possibly damaging 0.94
R6339:Sorl1 UTSW 9 41,881,038 (GRCm39) missense probably benign 0.10
R6484:Sorl1 UTSW 9 41,887,703 (GRCm39) missense probably damaging 1.00
R6505:Sorl1 UTSW 9 41,982,530 (GRCm39) missense probably damaging 1.00
R6591:Sorl1 UTSW 9 41,913,863 (GRCm39) missense probably damaging 1.00
R6596:Sorl1 UTSW 9 41,912,899 (GRCm39) missense possibly damaging 0.81
R6654:Sorl1 UTSW 9 41,891,941 (GRCm39) missense possibly damaging 0.47
R6691:Sorl1 UTSW 9 41,913,863 (GRCm39) missense probably damaging 1.00
R6702:Sorl1 UTSW 9 41,982,497 (GRCm39) missense probably damaging 0.97
R6703:Sorl1 UTSW 9 41,982,497 (GRCm39) missense probably damaging 0.97
R6775:Sorl1 UTSW 9 42,003,748 (GRCm39) missense possibly damaging 0.93
R6792:Sorl1 UTSW 9 42,010,559 (GRCm39) missense probably damaging 1.00
R6852:Sorl1 UTSW 9 41,935,694 (GRCm39) missense possibly damaging 0.90
R6860:Sorl1 UTSW 9 41,933,688 (GRCm39) missense probably benign 0.01
R6925:Sorl1 UTSW 9 41,944,922 (GRCm39) missense probably damaging 1.00
R7022:Sorl1 UTSW 9 41,881,047 (GRCm39) missense probably benign 0.11
R7033:Sorl1 UTSW 9 41,942,279 (GRCm39) missense possibly damaging 0.93
R7091:Sorl1 UTSW 9 41,913,930 (GRCm39) missense probably benign 0.00
R7267:Sorl1 UTSW 9 42,035,375 (GRCm39) missense possibly damaging 0.63
R7269:Sorl1 UTSW 9 41,948,499 (GRCm39) missense probably damaging 0.99
R7272:Sorl1 UTSW 9 41,975,006 (GRCm39) splice site probably null
R7537:Sorl1 UTSW 9 41,891,984 (GRCm39) missense probably benign 0.01
R7615:Sorl1 UTSW 9 41,888,878 (GRCm39) missense possibly damaging 0.91
R7636:Sorl1 UTSW 9 42,003,630 (GRCm39) missense possibly damaging 0.90
R7727:Sorl1 UTSW 9 41,895,822 (GRCm39) missense probably damaging 1.00
R7763:Sorl1 UTSW 9 41,955,205 (GRCm39) missense probably damaging 1.00
R7831:Sorl1 UTSW 9 42,001,257 (GRCm39) missense probably benign 0.17
R7956:Sorl1 UTSW 9 41,900,655 (GRCm39) missense probably damaging 1.00
R7964:Sorl1 UTSW 9 41,902,697 (GRCm39) missense probably damaging 1.00
R7977:Sorl1 UTSW 9 41,888,857 (GRCm39) missense probably damaging 1.00
R7987:Sorl1 UTSW 9 41,888,857 (GRCm39) missense probably damaging 1.00
R8151:Sorl1 UTSW 9 41,979,229 (GRCm39) missense probably damaging 0.99
R8219:Sorl1 UTSW 9 41,952,857 (GRCm39) splice site probably null
R8261:Sorl1 UTSW 9 41,925,777 (GRCm39) missense probably damaging 1.00
R8283:Sorl1 UTSW 9 41,942,294 (GRCm39) missense probably damaging 1.00
R8308:Sorl1 UTSW 9 41,929,456 (GRCm39) missense probably damaging 1.00
R8348:Sorl1 UTSW 9 41,903,041 (GRCm39) missense probably benign 0.35
R8448:Sorl1 UTSW 9 41,903,041 (GRCm39) missense probably benign 0.35
R8524:Sorl1 UTSW 9 41,885,370 (GRCm39) missense probably damaging 1.00
R8869:Sorl1 UTSW 9 41,933,722 (GRCm39) missense probably benign 0.01
R8898:Sorl1 UTSW 9 41,911,567 (GRCm39) missense probably damaging 1.00
R8972:Sorl1 UTSW 9 41,957,848 (GRCm39) missense probably damaging 1.00
R9012:Sorl1 UTSW 9 41,982,491 (GRCm39) missense probably damaging 1.00
R9094:Sorl1 UTSW 9 41,975,050 (GRCm39) missense possibly damaging 0.92
R9241:Sorl1 UTSW 9 41,885,420 (GRCm39) nonsense probably null
R9278:Sorl1 UTSW 9 41,957,857 (GRCm39) missense probably benign 0.01
R9288:Sorl1 UTSW 9 41,952,927 (GRCm39) missense probably damaging 1.00
R9303:Sorl1 UTSW 9 41,900,739 (GRCm39) missense probably damaging 1.00
R9330:Sorl1 UTSW 9 41,979,229 (GRCm39) missense probably damaging 1.00
R9332:Sorl1 UTSW 9 41,912,814 (GRCm39) missense probably damaging 1.00
R9468:Sorl1 UTSW 9 42,035,384 (GRCm39) missense probably benign 0.20
R9528:Sorl1 UTSW 9 41,933,631 (GRCm39) critical splice donor site probably null
R9544:Sorl1 UTSW 9 41,993,105 (GRCm39) nonsense probably null
R9563:Sorl1 UTSW 9 41,957,893 (GRCm39) missense probably damaging 1.00
R9564:Sorl1 UTSW 9 41,957,893 (GRCm39) missense probably damaging 1.00
R9588:Sorl1 UTSW 9 41,993,105 (GRCm39) nonsense probably null
R9634:Sorl1 UTSW 9 41,907,590 (GRCm39) missense probably benign
R9671:Sorl1 UTSW 9 41,943,077 (GRCm39) missense possibly damaging 0.85
R9701:Sorl1 UTSW 9 42,003,766 (GRCm39) missense probably damaging 1.00
Z1176:Sorl1 UTSW 9 42,035,244 (GRCm39) missense probably benign 0.03
Z1176:Sorl1 UTSW 9 42,010,499 (GRCm39) missense possibly damaging 0.64
Z1177:Sorl1 UTSW 9 42,017,837 (GRCm39) missense probably benign 0.00
Z1177:Sorl1 UTSW 9 41,902,934 (GRCm39) missense possibly damaging 0.92
Z1177:Sorl1 UTSW 9 42,035,208 (GRCm39) missense probably damaging 1.00
Z31818:Sorl1 UTSW 9 41,952,892 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTTCTGTGGGAAAAGGAAC -3'
(R):5'- TTCCGTGTCTATGCAGAGAC -3'

Sequencing Primer
(F):5'- GAACAACAAATGCAGGCCCAGG -3'
(R):5'- TTAGCAGTGTAGATATAGCAAGTGC -3'
Posted On 2015-10-08