Incidental Mutation 'R4664:Sorl1'
ID353113
Institutional Source Beutler Lab
Gene Symbol Sorl1
Ensembl Gene ENSMUSG00000049313
Gene Namesortilin-related receptor, LDLR class A repeats-containing
Synonyms2900010L19Rik, mSorLA, Sorla, LR11
MMRRC Submission 041922-MU
Accession Numbers

Genbank: NM_011436; MGI: 1202296

Is this an essential gene? Possibly non essential (E-score: 0.499) question?
Stock #R4664 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location41964720-42124297 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42004051 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1294 (M1294K)
Ref Sequence ENSEMBL: ENSMUSP00000058613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060989]
Predicted Effect probably damaging
Transcript: ENSMUST00000060989
AA Change: M1294K

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: M1294K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
VPS10 124 757 N/A SMART
LY 780 822 9.33e-6 SMART
LY 824 866 2.38e-12 SMART
LY 867 912 1.87e-5 SMART
LY 913 953 1.08e-10 SMART
LY 954 993 5.43e0 SMART
EGF_like 1020 1072 2.8e1 SMART
LDLa 1077 1114 1.76e-14 SMART
LDLa 1116 1155 5.34e-14 SMART
LDLa 1157 1194 1.67e-15 SMART
EGF_like 1198 1236 4.93e1 SMART
LDLa 1198 1237 3.83e-15 SMART
LDLa 1238 1273 1.99e-13 SMART
LDLa 1274 1317 2.53e-6 SMART
LDLa 1324 1361 4.34e-14 SMART
LDLa 1367 1405 1.14e-13 SMART
LDLa 1418 1455 3.34e-15 SMART
LDLa 1470 1508 1.09e-10 SMART
LDLa 1513 1551 1.09e-10 SMART
FN3 1555 1638 4.19e-4 SMART
FN3 1651 1732 7.23e-8 SMART
FN3 1747 1830 4.8e0 SMART
FN3 1842 1920 3e1 SMART
FN3 1933 2016 6.01e-5 SMART
FN3 2025 2107 2.03e-2 SMART
transmembrane domain 2137 2159 N/A INTRINSIC
low complexity region 2188 2199 N/A INTRINSIC
Meta Mutation Damage Score 0.2658 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (110/115)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]
Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock
Total: 106 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ano2 A G 6: 125,863,538 I391V probably benign Het
Apc T A 18: 34,298,594 L349M probably damaging Het
Atmin A G 8: 116,957,959 D786G probably damaging Het
Atp8a1 T A 5: 67,762,586 D379V possibly damaging Het
Aurkb A G 11: 69,048,609 K173E probably damaging Het
Bak1 T C 17: 27,022,536 I83V possibly damaging Het
Btbd17 A C 11: 114,794,006 V69G probably damaging Het
Cacna1a T A 8: 84,601,767 Y1597* probably null Het
Camk2a C A 18: 60,955,624 Q167K possibly damaging Het
Capn1 A T 19: 6,011,015 N253K probably benign Het
Ccer2 A G 7: 28,756,503 E40G probably benign Het
Cdc42bpa A G 1: 180,144,565 T527A probably damaging Het
Cdkl2 T C 5: 92,037,265 D89G probably damaging Het
Cep128 G T 12: 91,296,253 R291S probably damaging Het
Chd4 A G 6: 125,101,502 M203V possibly damaging Het
Chrna4 A G 2: 181,037,493 S54P probably damaging Het
Cic TGTTGCCCTC T 7: 25,290,674 probably benign Het
Cntn5 T A 9: 10,144,209 I152L possibly damaging Het
Cntn6 A G 6: 104,728,284 E154G probably benign Het
Col16a1 A C 4: 130,062,090 probably benign Het
Col4a3bp T C 13: 96,599,457 V175A probably benign Het
Cpvl C T 6: 53,931,933 E282K probably benign Het
Cyth2 T C 7: 45,810,719 D183G probably damaging Het
Ddx47 A T 6: 135,012,356 T48S possibly damaging Het
Dgkk A G X: 6,928,512 D685G probably benign Het
Dis3l C T 9: 64,330,798 S29N unknown Het
Dlg5 T C 14: 24,137,181 H1834R possibly damaging Het
Dnah10 T C 5: 124,828,472 M4060T possibly damaging Het
Dock3 T A 9: 106,993,544 N557I possibly damaging Het
Eprs A T 1: 185,373,076 probably benign Het
Faim2 C A 15: 99,524,700 probably null Het
Faim2 T G 15: 99,524,701 S72R probably benign Het
Fam84b A T 15: 60,823,629 D89E probably benign Het
Fanca T C 8: 123,268,972 T1364A probably damaging Het
Fance T C 17: 28,315,662 probably benign Het
Farsb A T 1: 78,443,765 H496Q possibly damaging Het
Fryl C T 5: 73,090,679 E1032K possibly damaging Het
Galnt14 A T 17: 73,507,813 probably benign Het
Gba2 A T 4: 43,568,619 probably benign Het
Gjb4 C A 4: 127,351,778 K123N probably damaging Het
Gmcl1 G A 6: 86,732,998 T56I probably benign Het
Gtf2ird1 T A 5: 134,383,902 E55V probably damaging Het
Gtpbp2 T C 17: 46,161,154 V5A probably benign Het
Hnrnpr A G 4: 136,317,175 probably null Het
Homer3 G A 8: 70,290,143 probably null Het
Hsd3b3 T C 3: 98,742,216 S264G probably damaging Het
Ints8 T C 4: 11,227,152 M574V probably benign Het
Kif4-ps G A 12: 101,149,218 noncoding transcript Het
Klhl14 A T 18: 21,554,708 N552K probably benign Het
Klhl40 A G 9: 121,780,733 E528G probably damaging Het
Lactb2 T C 1: 13,647,400 E133G probably damaging Het
Lrrtm2 T C 18: 35,214,257 probably null Het
Mab21l2 T A 3: 86,547,504 Y63F probably benign Het
Mbd1 T A 18: 74,269,526 I33N possibly damaging Het
Mertk G A 2: 128,801,212 V844M probably benign Het
Mgea5 T C 19: 45,771,945 E258G probably benign Het
Myh11 T C 16: 14,226,584 T652A possibly damaging Het
Nlrp4a C A 7: 26,449,518 Y183* probably null Het
Noa1 T A 5: 77,299,753 T558S probably benign Het
Nol11 A T 11: 107,181,000 S256T possibly damaging Het
Nr1d1 G T 11: 98,771,260 R183S possibly damaging Het
Nrg2 G T 18: 36,052,895 Q264K possibly damaging Het
Nsd3 T A 8: 25,698,866 F1027I probably damaging Het
Ntrk3 T A 7: 78,461,099 I285F probably damaging Het
Obox8 T C 7: 14,332,846 N91S possibly damaging Het
Orc5 C T 5: 22,546,522 S63N probably benign Het
Osbpl6 C T 2: 76,568,208 T412I probably benign Het
P2ry14 C T 3: 59,115,142 C308Y probably damaging Het
Pacsin1 T C 17: 27,707,064 F127L probably damaging Het
Pex11b T C 3: 96,643,835 L198P possibly damaging Het
Pla2g4e A T 2: 120,171,188 V660E probably damaging Het
Plxna4 C A 6: 32,516,950 V244F possibly damaging Het
Polr3b A G 10: 84,714,369 Y981C probably damaging Het
Popdc2 T A 16: 38,374,287 S357T probably damaging Het
Prr29 A G 11: 106,376,333 H58R probably damaging Het
Pyy T A 11: 102,107,352 M1L possibly damaging Het
Rasd2 T C 8: 75,221,928 S161P possibly damaging Het
Ryr3 C T 2: 112,996,555 probably benign Het
Sectm1a G A 11: 121,069,726 R88C possibly damaging Het
Serpinb13 C T 1: 106,982,844 S66L probably damaging Het
Siglecf A T 7: 43,356,413 I465F possibly damaging Het
Spam1 A T 6: 24,796,662 H204L probably benign Het
Sspo A T 6: 48,473,534 N2586Y possibly damaging Het
Tbc1d4 A G 14: 101,462,827 probably benign Het
Tceanc2 A T 4: 107,165,560 S77T probably damaging Het
Tedc2 A G 17: 24,220,140 probably benign Het
Tgm6 A G 2: 130,137,394 D148G probably benign Het
Tgm6 A T 2: 130,141,208 Q239L probably benign Het
Thsd7a T A 6: 12,337,314 T1235S possibly damaging Het
Thsd7a T A 6: 12,504,013 I381F possibly damaging Het
Tmc4 T C 7: 3,671,271 probably null Het
Tmem54 A T 4: 129,110,911 E186D possibly damaging Het
Tpk1 A T 6: 43,611,335 F32I probably benign Het
Trpc4ap A G 2: 155,672,997 I97T probably benign Het
Txlnb A G 10: 17,843,194 E591G probably damaging Het
Tyk2 C T 9: 21,114,207 A741T probably damaging Het
Ubr4 G A 4: 139,406,518 E742K possibly damaging Het
Uckl1 A T 2: 181,574,868 S95T possibly damaging Het
Uevld T A 7: 46,937,986 D322V probably damaging Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn1r238 G T 18: 3,123,300 T38K probably damaging Het
Vps8 T A 16: 21,444,188 probably null Het
Wdr60 T C 12: 116,256,211 E37G probably damaging Het
Wdr83 T C 8: 85,080,051 probably benign Het
Zcchc6 G A 13: 59,800,599 T636I possibly damaging Het
Zfp619 A G 7: 39,534,135 T51A probably benign Het
Other mutations in Sorl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00087:Sorl1 APN 9 41974094 missense probably damaging 1.00
IGL01303:Sorl1 APN 9 42024478 splice site probably benign
IGL01545:Sorl1 APN 9 42043956 missense probably damaging 1.00
IGL01629:Sorl1 APN 9 42057269 critical splice donor site probably null
IGL01670:Sorl1 APN 9 42001492 missense possibly damaging 0.81
IGL01684:Sorl1 APN 9 41980711 missense probably damaging 0.96
IGL02154:Sorl1 APN 9 42004034 missense probably benign
IGL02215:Sorl1 APN 9 42018182 missense probably damaging 0.97
IGL02427:Sorl1 APN 9 42041690 missense probably damaging 1.00
IGL02590:Sorl1 APN 9 42046561 missense probably benign 0.01
IGL02794:Sorl1 APN 9 42063774 missense probably damaging 0.98
IGL02797:Sorl1 APN 9 42037059 missense probably damaging 0.99
IGL02987:Sorl1 APN 9 42041053 missense probably damaging 1.00
IGL03005:Sorl1 APN 9 42057325 missense probably damaging 1.00
IGL03069:Sorl1 APN 9 41991426 missense probably benign
IGL03288:Sorl1 APN 9 42033562 splice site probably benign
N/A - 287:Sorl1 UTSW 9 42041596 nonsense probably null
PIT4151001:Sorl1 UTSW 9 41968622 missense probably damaging 1.00
R0117:Sorl1 UTSW 9 42033577 missense probably benign 0.10
R0173:Sorl1 UTSW 9 42067933 missense probably damaging 0.99
R0318:Sorl1 UTSW 9 42081954 missense probably damaging 1.00
R0385:Sorl1 UTSW 9 42031909 missense probably damaging 0.99
R0448:Sorl1 UTSW 9 42004088 missense probably damaging 1.00
R0492:Sorl1 UTSW 9 41991371 missense probably null 0.00
R0512:Sorl1 UTSW 9 42067832 missense probably benign 0.01
R0587:Sorl1 UTSW 9 41984506 missense probably damaging 1.00
R0600:Sorl1 UTSW 9 42043900 splice site probably benign
R0831:Sorl1 UTSW 9 42071069 splice site probably benign
R0924:Sorl1 UTSW 9 42008174 splice site probably benign
R1013:Sorl1 UTSW 9 42002559 missense probably benign 0.00
R1053:Sorl1 UTSW 9 41991456 missense probably benign
R1077:Sorl1 UTSW 9 42014490 missense probably damaging 1.00
R1326:Sorl1 UTSW 9 42031796 missense probably benign 0.14
R1348:Sorl1 UTSW 9 42000412 splice site probably null
R1498:Sorl1 UTSW 9 42041073 missense probably damaging 1.00
R1671:Sorl1 UTSW 9 41974000 missense probably damaging 1.00
R1713:Sorl1 UTSW 9 41996242 missense probably benign 0.06
R1738:Sorl1 UTSW 9 42089965 missense probably benign 0.33
R1779:Sorl1 UTSW 9 41991482 critical splice acceptor site probably null
R1871:Sorl1 UTSW 9 41969725 nonsense probably null
R1912:Sorl1 UTSW 9 42081950 missense probably damaging 1.00
R1952:Sorl1 UTSW 9 42046624 missense probably benign
R2071:Sorl1 UTSW 9 41979457 missense possibly damaging 0.71
R2153:Sorl1 UTSW 9 41984492 missense probably benign 0.01
R2417:Sorl1 UTSW 9 41980711 missense probably damaging 0.96
R2429:Sorl1 UTSW 9 42037070 missense probably damaging 1.00
R2866:Sorl1 UTSW 9 41969781 missense probably benign
R3815:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3816:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3817:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3819:Sorl1 UTSW 9 42064049 missense possibly damaging 0.71
R3890:Sorl1 UTSW 9 42004105 missense probably damaging 1.00
R3941:Sorl1 UTSW 9 41989468 critical splice acceptor site probably null
R4409:Sorl1 UTSW 9 42035448 missense probably damaging 0.99
R4410:Sorl1 UTSW 9 42003992 nonsense probably null
R4610:Sorl1 UTSW 9 42031914 missense possibly damaging 0.65
R4666:Sorl1 UTSW 9 42004051 missense probably damaging 0.97
R4668:Sorl1 UTSW 9 41984508 missense probably damaging 1.00
R4823:Sorl1 UTSW 9 41992321 missense probably damaging 1.00
R4874:Sorl1 UTSW 9 42063752 missense probably damaging 0.99
R4898:Sorl1 UTSW 9 42041639 missense probably damaging 1.00
R4922:Sorl1 UTSW 9 42014450 splice site probably null
R4976:Sorl1 UTSW 9 41983003 missense probably benign 0.00
R4984:Sorl1 UTSW 9 41991342 missense probably damaging 1.00
R5046:Sorl1 UTSW 9 41996294 missense probably benign
R5070:Sorl1 UTSW 9 42031818 missense possibly damaging 0.82
R5084:Sorl1 UTSW 9 41976377 missense probably benign 0.01
R5202:Sorl1 UTSW 9 42033583 missense probably benign 0.00
R5265:Sorl1 UTSW 9 42106516 missense possibly damaging 0.80
R5275:Sorl1 UTSW 9 42030902 missense probably benign 0.33
R5368:Sorl1 UTSW 9 41979390 missense probably benign 0.00
R5385:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5386:Sorl1 UTSW 9 42057284 missense possibly damaging 0.83
R5416:Sorl1 UTSW 9 42002636 nonsense probably null
R5518:Sorl1 UTSW 9 42037212 missense possibly damaging 0.92
R5545:Sorl1 UTSW 9 41991625 missense probably benign 0.08
R5864:Sorl1 UTSW 9 42092373 missense probably damaging 1.00
R5865:Sorl1 UTSW 9 41983034 missense possibly damaging 0.94
R6339:Sorl1 UTSW 9 41969742 missense probably benign 0.10
R6484:Sorl1 UTSW 9 41976407 missense probably damaging 1.00
R6505:Sorl1 UTSW 9 42071234 missense probably damaging 1.00
R6591:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6596:Sorl1 UTSW 9 42001603 missense possibly damaging 0.81
R6654:Sorl1 UTSW 9 41980645 missense possibly damaging 0.47
R6691:Sorl1 UTSW 9 42002567 missense probably damaging 1.00
R6702:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6703:Sorl1 UTSW 9 42071201 missense probably damaging 0.97
R6775:Sorl1 UTSW 9 42092452 missense possibly damaging 0.93
R6792:Sorl1 UTSW 9 42099263 missense probably damaging 1.00
R6852:Sorl1 UTSW 9 42024398 missense possibly damaging 0.90
R6860:Sorl1 UTSW 9 42022392 missense probably benign 0.01
R6925:Sorl1 UTSW 9 42033626 missense probably damaging 1.00
R7022:Sorl1 UTSW 9 41969751 missense probably benign 0.11
R7033:Sorl1 UTSW 9 42030983 missense possibly damaging 0.93
R7091:Sorl1 UTSW 9 42002634 missense probably benign 0.00
R7267:Sorl1 UTSW 9 42124079 missense possibly damaging 0.63
R7269:Sorl1 UTSW 9 42037203 missense probably damaging 0.99
R7272:Sorl1 UTSW 9 42063710 splice site probably null
R7537:Sorl1 UTSW 9 41980688 missense probably benign 0.01
R7615:Sorl1 UTSW 9 41977582 missense possibly damaging 0.91
R7636:Sorl1 UTSW 9 42092334 missense possibly damaging 0.90
R7727:Sorl1 UTSW 9 41984526 missense probably damaging 1.00
Z31818:Sorl1 UTSW 9 42041596 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCTTCTGTGGGAAAAGGAAC -3'
(R):5'- TTCCGTGTCTATGCAGAGAC -3'

Sequencing Primer
(F):5'- GAACAACAAATGCAGGCCCAGG -3'
(R):5'- TTAGCAGTGTAGATATAGCAAGTGC -3'
Posted On2015-10-08