Mutagenetix > Incidental Mutation

Incidental Mutation 'R4664:Sorl1'

353113

Institutional Source

Beutler Lab

Gene Symbol

Sorl1

Ensembl Gene

ENSMUSG00000049313

Gene Name

sortilin-related receptor, LDLR class A repeats-containing

Synonyms

2900010L19Rik, mSorLA, Sorla, LR11

MMRRC Submission

041922-MU

Accession Numbers

Genbank: NM_011436; MGI: 1202296

Essential gene?

Possibly non essential (E-score: 0.338) question?

Stock #

R4664 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

41964720-42124297 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 42004051 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Lysine at position 1294 (M1294K)

Ref Sequence

ENSEMBL: ENSMUSP00000058613 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060989]

AlphaFold

O88307

Predicted Effect

probably damaging
Transcript: ENSMUST00000060989
AA Change: M1294K

PolyPhen 2 Score 0.969 (Sensitivity: 0.77; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: M1294K

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
VPS10	124	757	N/A	SMART
LY	780	822	9.33e-6	SMART
LY	824	866	2.38e-12	SMART
LY	867	912	1.87e-5	SMART
LY	913	953	1.08e-10	SMART
LY	954	993	5.43e0	SMART
EGF_like	1020	1072	2.8e1	SMART
LDLa	1077	1114	1.76e-14	SMART
LDLa	1116	1155	5.34e-14	SMART
LDLa	1157	1194	1.67e-15	SMART
EGF_like	1198	1236	4.93e1	SMART
LDLa	1198	1237	3.83e-15	SMART
LDLa	1238	1273	1.99e-13	SMART
LDLa	1274	1317	2.53e-6	SMART
LDLa	1324	1361	4.34e-14	SMART
LDLa	1367	1405	1.14e-13	SMART
LDLa	1418	1455	3.34e-15	SMART
LDLa	1470	1508	1.09e-10	SMART
LDLa	1513	1551	1.09e-10	SMART
FN3	1555	1638	4.19e-4	SMART
FN3	1651	1732	7.23e-8	SMART
FN3	1747	1830	4.8e0	SMART
FN3	1842	1920	3e1	SMART
FN3	1933	2016	6.01e-5	SMART
FN3	2025	2107	2.03e-2	SMART
transmembrane domain	2137	2159	N/A	INTRINSIC
low complexity region	2188	2199	N/A	INTRINSIC

Meta Mutation Damage Score

0.2658

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 95.2%

Validation Efficiency

96% (110/115)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]

Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock

Total: 106 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ano2	A	G	6: 125,863,538	I391V	probably benign	Het
Apc	T	A	18: 34,298,594	L349M	probably damaging	Het
Atmin	A	G	8: 116,957,959	D786G	probably damaging	Het
Atp8a1	T	A	5: 67,762,586	D379V	possibly damaging	Het
Aurkb	A	G	11: 69,048,609	K173E	probably damaging	Het
Bak1	T	C	17: 27,022,536	I83V	possibly damaging	Het
Btbd17	A	C	11: 114,794,006	V69G	probably damaging	Het
Cacna1a	T	A	8: 84,601,767	Y1597*	probably null	Het
Camk2a	C	A	18: 60,955,624	Q167K	possibly damaging	Het
Capn1	A	T	19: 6,011,015	N253K	probably benign	Het
Ccer2	A	G	7: 28,756,503	E40G	probably benign	Het
Cdc42bpa	A	G	1: 180,144,565	T527A	probably damaging	Het
Cdkl2	T	C	5: 92,037,265	D89G	probably damaging	Het
Cep128	G	T	12: 91,296,253	R291S	probably damaging	Het
Chd4	A	G	6: 125,101,502	M203V	possibly damaging	Het
Chrna4	A	G	2: 181,037,493	S54P	probably damaging	Het
Cic	TGTTGCCCTC	T	7: 25,290,674		probably benign	Het
Cntn5	T	A	9: 10,144,209	I152L	possibly damaging	Het
Cntn6	A	G	6: 104,728,284	E154G	probably benign	Het
Col16a1	A	C	4: 130,062,090		probably benign	Het
Col4a3bp	T	C	13: 96,599,457	V175A	probably benign	Het
Cpvl	C	T	6: 53,931,933	E282K	probably benign	Het
Cyth2	T	C	7: 45,810,719	D183G	probably damaging	Het
Ddx47	A	T	6: 135,012,356	T48S	possibly damaging	Het
Dgkk	A	G	X: 6,928,512	D685G	probably benign	Het
Dis3l	C	T	9: 64,330,798	S29N	unknown	Het
Dlg5	T	C	14: 24,137,181	H1834R	possibly damaging	Het
Dnah10	T	C	5: 124,828,472	M4060T	possibly damaging	Het
Dock3	T	A	9: 106,993,544	N557I	possibly damaging	Het
Eprs	A	T	1: 185,373,076		probably benign	Het
Faim2	C	A	15: 99,524,700		probably null	Het
Faim2	T	G	15: 99,524,701	S72R	probably benign	Het
Fam84b	A	T	15: 60,823,629	D89E	probably benign	Het
Fanca	T	C	8: 123,268,972	T1364A	probably damaging	Het
Fance	T	C	17: 28,315,662		probably benign	Het
Farsb	A	T	1: 78,443,765	H496Q	possibly damaging	Het
Fryl	C	T	5: 73,090,679	E1032K	possibly damaging	Het
Galnt14	A	T	17: 73,507,813		probably benign	Het
Gba2	A	T	4: 43,568,619		probably benign	Het
Gjb4	C	A	4: 127,351,778	K123N	probably damaging	Het
Gmcl1	G	A	6: 86,732,998	T56I	probably benign	Het
Gtf2ird1	T	A	5: 134,383,902	E55V	probably damaging	Het
Gtpbp2	T	C	17: 46,161,154	V5A	probably benign	Het
Hnrnpr	A	G	4: 136,317,175		probably benign	Het
Homer3	G	A	8: 70,290,143		probably null	Het
Hsd3b3	T	C	3: 98,742,216	S264G	probably damaging	Het
Ints8	T	C	4: 11,227,152	M574V	probably benign	Het
Kif4-ps	G	A	12: 101,149,218		noncoding transcript	Het
Klhl14	A	T	18: 21,554,708	N552K	probably benign	Het
Klhl40	A	G	9: 121,780,733	E528G	probably damaging	Het
Lactb2	T	C	1: 13,647,400	E133G	probably damaging	Het
Lrrtm2	T	C	18: 35,214,257		probably null	Het
Mab21l2	T	A	3: 86,547,504	Y63F	probably benign	Het
Mbd1	T	A	18: 74,269,526	I33N	possibly damaging	Het
Mertk	G	A	2: 128,801,212	V844M	probably benign	Het
Mgea5	T	C	19: 45,771,945	E258G	probably benign	Het
Myh11	T	C	16: 14,226,584	T652A	possibly damaging	Het
Nlrp4a	C	A	7: 26,449,518	Y183*	probably null	Het
Noa1	T	A	5: 77,299,753	T558S	probably benign	Het
Nol11	A	T	11: 107,181,000	S256T	possibly damaging	Het
Nr1d1	G	T	11: 98,771,260	R183S	possibly damaging	Het
Nrg2	G	T	18: 36,052,895	Q264K	possibly damaging	Het
Nsd3	T	A	8: 25,698,866	F1027I	probably damaging	Het
Ntrk3	T	A	7: 78,461,099	I285F	probably damaging	Het
Obox8	T	C	7: 14,332,846	N91S	possibly damaging	Het
Orc5	C	T	5: 22,546,522	S63N	probably benign	Het
Osbpl6	C	T	2: 76,568,208	T412I	probably benign	Het
P2ry14	C	T	3: 59,115,142	C308Y	probably damaging	Het
Pacsin1	T	C	17: 27,707,064	F127L	probably damaging	Het
Pex11b	T	C	3: 96,643,835	L198P	possibly damaging	Het
Pla2g4e	A	T	2: 120,171,188	V660E	probably damaging	Het
Plxna4	C	A	6: 32,516,950	V244F	possibly damaging	Het
Polr3b	A	G	10: 84,714,369	Y981C	probably damaging	Het
Popdc2	T	A	16: 38,374,287	S357T	probably damaging	Het
Prr29	A	G	11: 106,376,333	H58R	probably damaging	Het
Pyy	T	A	11: 102,107,352	M1L	possibly damaging	Het
Rasd2	T	C	8: 75,221,928	S161P	possibly damaging	Het
Ryr3	C	T	2: 112,996,555		probably benign	Het
Sectm1a	G	A	11: 121,069,726	R88C	possibly damaging	Het
Serpinb13	C	T	1: 106,982,844	S66L	probably damaging	Het
Siglecf	A	T	7: 43,356,413	I465F	possibly damaging	Het
Spam1	A	T	6: 24,796,662	H204L	probably benign	Het
Sspo	A	T	6: 48,473,534	N2586Y	possibly damaging	Het
Tbc1d4	A	G	14: 101,462,827		probably benign	Het
Tceanc2	A	T	4: 107,165,560	S77T	probably damaging	Het
Tedc2	A	G	17: 24,220,140		probably benign	Het
Tgm6	A	G	2: 130,137,394	D148G	probably benign	Het
Tgm6	A	T	2: 130,141,208	Q239L	probably benign	Het
Thsd7a	T	A	6: 12,337,314	T1235S	possibly damaging	Het
Thsd7a	T	A	6: 12,504,013	I381F	possibly damaging	Het
Tmc4	T	C	7: 3,671,271		probably null	Het
Tmem54	A	T	4: 129,110,911	E186D	possibly damaging	Het
Tpk1	A	T	6: 43,611,335	F32I	probably benign	Het
Trpc4ap	A	G	2: 155,672,997	I97T	probably benign	Het
Txlnb	A	G	10: 17,843,194	E591G	probably damaging	Het
Tyk2	C	T	9: 21,114,207	A741T	probably damaging	Het
Ubr4	G	A	4: 139,406,518	E742K	possibly damaging	Het
Uckl1	A	T	2: 181,574,868	S95T	possibly damaging	Het
Uevld	T	A	7: 46,937,986	D322V	probably damaging	Het
Ugt1a1	CAGAGAGAGAGAGA	CAGAGAGAGAGA	1: 88,211,984		probably benign	Het
Vmn1r238	G	T	18: 3,123,300	T38K	probably damaging	Het
Vps8	T	A	16: 21,444,188		probably null	Het
Wdr60	T	C	12: 116,256,211	E37G	probably damaging	Het
Wdr83	T	C	8: 85,080,051		probably benign	Het
Zcchc6	G	A	13: 59,800,599	T636I	possibly damaging	Het
Zfp619	A	G	7: 39,534,135	T51A	probably benign	Het

Other mutations in Sorl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Sorl1	APN	9	41974094	missense	probably damaging	1.00
IGL01303:Sorl1	APN	9	42024478	splice site	probably benign
IGL01545:Sorl1	APN	9	42043956	missense	probably damaging	1.00
IGL01629:Sorl1	APN	9	42057269	critical splice donor site	probably null
IGL01670:Sorl1	APN	9	42001492	missense	possibly damaging	0.81
IGL01684:Sorl1	APN	9	41980711	missense	probably damaging	0.96
IGL02154:Sorl1	APN	9	42004034	missense	probably benign
IGL02215:Sorl1	APN	9	42018182	missense	probably damaging	0.97
IGL02427:Sorl1	APN	9	42041690	missense	probably damaging	1.00
IGL02590:Sorl1	APN	9	42046561	missense	probably benign	0.01
IGL02794:Sorl1	APN	9	42063774	missense	probably damaging	0.98
IGL02797:Sorl1	APN	9	42037059	missense	probably damaging	0.99
IGL02987:Sorl1	APN	9	42041053	missense	probably damaging	1.00
IGL03005:Sorl1	APN	9	42057325	missense	probably damaging	1.00
IGL03069:Sorl1	APN	9	41991426	missense	probably benign
IGL03288:Sorl1	APN	9	42033562	splice site	probably benign
N/A - 287:Sorl1	UTSW	9	42041596	nonsense	probably null
PIT4151001:Sorl1	UTSW	9	41968622	missense	probably damaging	1.00
R0117:Sorl1	UTSW	9	42033577	missense	probably benign	0.10
R0173:Sorl1	UTSW	9	42067933	missense	probably damaging	0.99
R0318:Sorl1	UTSW	9	42081954	missense	probably damaging	1.00
R0385:Sorl1	UTSW	9	42031909	missense	probably damaging	0.99
R0448:Sorl1	UTSW	9	42004088	missense	probably damaging	1.00
R0492:Sorl1	UTSW	9	41991371	missense	probably null	0.00
R0512:Sorl1	UTSW	9	42067832	missense	probably benign	0.01
R0587:Sorl1	UTSW	9	41984506	missense	probably damaging	1.00
R0600:Sorl1	UTSW	9	42043900	splice site	probably benign
R0831:Sorl1	UTSW	9	42071069	splice site	probably benign
R0924:Sorl1	UTSW	9	42008174	splice site	probably benign
R1013:Sorl1	UTSW	9	42002559	missense	probably benign	0.00
R1053:Sorl1	UTSW	9	41991456	missense	probably benign
R1077:Sorl1	UTSW	9	42014490	missense	probably damaging	1.00
R1326:Sorl1	UTSW	9	42031796	missense	probably benign	0.14
R1348:Sorl1	UTSW	9	42000412	splice site	probably null
R1498:Sorl1	UTSW	9	42041073	missense	probably damaging	1.00
R1671:Sorl1	UTSW	9	41974000	missense	probably damaging	1.00
R1713:Sorl1	UTSW	9	41996242	missense	probably benign	0.06
R1738:Sorl1	UTSW	9	42089965	missense	probably benign	0.33
R1779:Sorl1	UTSW	9	41991482	critical splice acceptor site	probably null
R1871:Sorl1	UTSW	9	41969725	nonsense	probably null
R1912:Sorl1	UTSW	9	42081950	missense	probably damaging	1.00
R1952:Sorl1	UTSW	9	42046624	missense	probably benign
R2071:Sorl1	UTSW	9	41979457	missense	possibly damaging	0.71
R2153:Sorl1	UTSW	9	41984492	missense	probably benign	0.01
R2417:Sorl1	UTSW	9	41980711	missense	probably damaging	0.96
R2429:Sorl1	UTSW	9	42037070	missense	probably damaging	1.00
R2866:Sorl1	UTSW	9	41969781	missense	probably benign
R3815:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3816:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3817:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3819:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3890:Sorl1	UTSW	9	42004105	missense	probably damaging	1.00
R3941:Sorl1	UTSW	9	41989468	critical splice acceptor site	probably null
R4409:Sorl1	UTSW	9	42035448	missense	probably damaging	0.99
R4410:Sorl1	UTSW	9	42003992	nonsense	probably null
R4610:Sorl1	UTSW	9	42031914	missense	possibly damaging	0.65
R4666:Sorl1	UTSW	9	42004051	missense	probably damaging	0.97
R4668:Sorl1	UTSW	9	41984508	missense	probably damaging	1.00
R4823:Sorl1	UTSW	9	41992321	missense	probably damaging	1.00
R4874:Sorl1	UTSW	9	42063752	missense	probably damaging	0.99
R4898:Sorl1	UTSW	9	42041639	missense	probably damaging	1.00
R4922:Sorl1	UTSW	9	42014450	splice site	probably null
R4976:Sorl1	UTSW	9	41983003	missense	probably benign	0.00
R4984:Sorl1	UTSW	9	41991342	missense	probably damaging	1.00
R5046:Sorl1	UTSW	9	41996294	missense	probably benign
R5070:Sorl1	UTSW	9	42031818	missense	possibly damaging	0.82
R5084:Sorl1	UTSW	9	41976377	missense	probably benign	0.01
R5202:Sorl1	UTSW	9	42033583	missense	probably benign	0.00
R5265:Sorl1	UTSW	9	42106516	missense	possibly damaging	0.80
R5275:Sorl1	UTSW	9	42030902	missense	probably benign	0.33
R5368:Sorl1	UTSW	9	41979390	missense	probably benign	0.00
R5385:Sorl1	UTSW	9	42057284	missense	possibly damaging	0.83
R5386:Sorl1	UTSW	9	42057284	missense	possibly damaging	0.83
R5416:Sorl1	UTSW	9	42002636	nonsense	probably null
R5518:Sorl1	UTSW	9	42037212	missense	possibly damaging	0.92
R5545:Sorl1	UTSW	9	41991625	missense	probably benign	0.08
R5864:Sorl1	UTSW	9	42092373	missense	probably damaging	1.00
R5865:Sorl1	UTSW	9	41983034	missense	possibly damaging	0.94
R6339:Sorl1	UTSW	9	41969742	missense	probably benign	0.10
R6484:Sorl1	UTSW	9	41976407	missense	probably damaging	1.00
R6505:Sorl1	UTSW	9	42071234	missense	probably damaging	1.00
R6591:Sorl1	UTSW	9	42002567	missense	probably damaging	1.00
R6596:Sorl1	UTSW	9	42001603	missense	possibly damaging	0.81
R6654:Sorl1	UTSW	9	41980645	missense	possibly damaging	0.47
R6691:Sorl1	UTSW	9	42002567	missense	probably damaging	1.00
R6702:Sorl1	UTSW	9	42071201	missense	probably damaging	0.97
R6703:Sorl1	UTSW	9	42071201	missense	probably damaging	0.97
R6775:Sorl1	UTSW	9	42092452	missense	possibly damaging	0.93
R6792:Sorl1	UTSW	9	42099263	missense	probably damaging	1.00
R6852:Sorl1	UTSW	9	42024398	missense	possibly damaging	0.90
R6860:Sorl1	UTSW	9	42022392	missense	probably benign	0.01
R6925:Sorl1	UTSW	9	42033626	missense	probably damaging	1.00
R7022:Sorl1	UTSW	9	41969751	missense	probably benign	0.11
R7033:Sorl1	UTSW	9	42030983	missense	possibly damaging	0.93
R7091:Sorl1	UTSW	9	42002634	missense	probably benign	0.00
R7267:Sorl1	UTSW	9	42124079	missense	possibly damaging	0.63
R7269:Sorl1	UTSW	9	42037203	missense	probably damaging	0.99
R7272:Sorl1	UTSW	9	42063710	splice site	probably null
R7537:Sorl1	UTSW	9	41980688	missense	probably benign	0.01
R7615:Sorl1	UTSW	9	41977582	missense	possibly damaging	0.91
R7636:Sorl1	UTSW	9	42092334	missense	possibly damaging	0.90
R7727:Sorl1	UTSW	9	41984526	missense	probably damaging	1.00
R7763:Sorl1	UTSW	9	42043909	missense	probably damaging	1.00
R7831:Sorl1	UTSW	9	42089961	missense	probably benign	0.17
R7956:Sorl1	UTSW	9	41989359	missense	probably damaging	1.00
R7964:Sorl1	UTSW	9	41991401	missense	probably damaging	1.00
R7977:Sorl1	UTSW	9	41977561	missense	probably damaging	1.00
R7987:Sorl1	UTSW	9	41977561	missense	probably damaging	1.00
R8151:Sorl1	UTSW	9	42067933	missense	probably damaging	0.99
R8219:Sorl1	UTSW	9	42041561	splice site	probably null
R8261:Sorl1	UTSW	9	42014481	missense	probably damaging	1.00
R8283:Sorl1	UTSW	9	42030998	missense	probably damaging	1.00
R8308:Sorl1	UTSW	9	42018160	missense	probably damaging	1.00
R8348:Sorl1	UTSW	9	41991745	missense	probably benign	0.35
R8448:Sorl1	UTSW	9	41991745	missense	probably benign	0.35
R8524:Sorl1	UTSW	9	41974074	missense	probably damaging	1.00
R8869:Sorl1	UTSW	9	42022426	missense	probably benign	0.01
R8898:Sorl1	UTSW	9	42000271	missense	probably damaging	1.00
R8972:Sorl1	UTSW	9	42046552	missense	probably damaging	1.00
R9012:Sorl1	UTSW	9	42071195	missense	probably damaging	1.00
R9094:Sorl1	UTSW	9	42063754	missense	possibly damaging	0.92
R9241:Sorl1	UTSW	9	41974124	nonsense	probably null
R9278:Sorl1	UTSW	9	42046561	missense	probably benign	0.01
R9288:Sorl1	UTSW	9	42041631	missense	probably damaging	1.00
R9303:Sorl1	UTSW	9	41989443	missense	probably damaging	1.00
R9330:Sorl1	UTSW	9	42067933	missense	probably damaging	1.00
R9332:Sorl1	UTSW	9	42001518	missense	probably damaging	1.00
R9468:Sorl1	UTSW	9	42124088	missense	probably benign	0.20
R9528:Sorl1	UTSW	9	42022335	critical splice donor site	probably null
R9544:Sorl1	UTSW	9	42081809	nonsense	probably null
R9563:Sorl1	UTSW	9	42046597	missense	probably damaging	1.00
R9564:Sorl1	UTSW	9	42046597	missense	probably damaging	1.00
R9588:Sorl1	UTSW	9	42081809	nonsense	probably null
R9634:Sorl1	UTSW	9	41996294	missense	probably benign
R9671:Sorl1	UTSW	9	42031781	missense	possibly damaging	0.85
R9701:Sorl1	UTSW	9	42092470	missense	probably damaging	1.00
Z1176:Sorl1	UTSW	9	42099203	missense	possibly damaging	0.64
Z1176:Sorl1	UTSW	9	42123948	missense	probably benign	0.03
Z1177:Sorl1	UTSW	9	41991638	missense	possibly damaging	0.92
Z1177:Sorl1	UTSW	9	42106541	missense	probably benign	0.00
Z1177:Sorl1	UTSW	9	42123912	missense	probably damaging	1.00
Z31818:Sorl1	UTSW	9	42041596	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCTTCTGTGGGAAAAGGAAC -3'
(R):5'- TTCCGTGTCTATGCAGAGAC -3'

Sequencing Primer
(F):5'- GAACAACAAATGCAGGCCCAGG -3'
(R):5'- TTAGCAGTGTAGATATAGCAAGTGC -3'

Posted On

2015-10-08