Mutagenetix > Incidental Mutation

Incidental Mutation 'R3852:AY358078'

353157

Institutional Source

Beutler Lab

Gene Symbol

AY358078

Ensembl Gene

ENSMUSG00000050961

Gene Name

cDNA sequence AY358078

Synonyms

MMRRC Submission

040784-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.057) question?

Stock #

R3852 (G1)

Quality Score

Status

Validated

Chromosome

Chromosomal Location

51800046-51826359 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 51805553 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 233 (T233A)

Ref Sequence

ENSEMBL: ENSMUSP00000078129 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053821]

AlphaFold

Q6UY53

Predicted Effect

unknown
Transcript: ENSMUST00000053821
AA Change: T233A

SMART Domains

Protein: ENSMUSP00000078129
Gene: ENSMUSG00000050961
AA Change: T233A

Domain	Start	End	E-Value	Type
Pfam:Takusan	91	171	5.5e-26	PFAM
coiled coil region	187	220	N/A	INTRINSIC

Meta Mutation Damage Score

0.0869

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.5%
20x: 95.7%

Validation Efficiency

96% (45/47)

Allele List at MGI

Other mutations in this stock

Total: 44 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcf3	T	C	16: 20,560,439	V685A	probably damaging	Het
Abhd4	T	C	14: 54,265,367	Y44H	probably damaging	Het
AI429214	A	G	8: 36,994,442	D248G	probably damaging	Het
Calcr	T	C	6: 3,693,735	Y353C	probably damaging	Het
Ccdc34	A	G	2: 110,032,428	K193E	possibly damaging	Het
Dhcr24	A	G	4: 106,573,873	E253G	probably benign	Het
Dnah6	A	G	6: 73,127,927	V1841A	possibly damaging	Het
Dpp10	A	T	1: 123,485,924	Y186*	probably null	Het
Dpysl4	C	T	7: 139,100,935	T575M	probably damaging	Het
Dusp7	T	A	9: 106,373,893	S406T	probably benign	Het
Gga3	T	A	11: 115,587,542	T475S	probably benign	Het
Gm10271	T	A	10: 116,956,874	K36*	probably null	Het
Gm572	G	A	4: 148,668,872	E325K	possibly damaging	Het
Golga2	A	G	2: 32,305,611	E806G	probably benign	Het
Igf1	A	T	10: 87,915,319	K126*	probably null	Het
Itpkc	A	T	7: 27,227,612	N292K	probably benign	Het
Klhl1	A	T	14: 96,280,205	M345K	probably benign	Het
Lrp2	A	G	2: 69,537,565	V201A	probably damaging	Het
Lrrc8a	C	T	2: 30,261,960	T757M	probably benign	Het
Mios	T	A	6: 8,216,453	I459K	probably benign	Het
Mrps11	T	C	7: 78,790,645	I94T	probably damaging	Het
Ms4a4c	T	A	19: 11,416,395	S68T	probably benign	Het
Mstn	C	T	1: 53,061,971	T69I	possibly damaging	Het
Myo10	A	G	15: 25,779,626	K28E	probably damaging	Het
Nol6	A	G	4: 41,117,452	S914P	probably damaging	Het
Ntn1	C	G	11: 68,385,793	D110H	probably damaging	Het
Olfr547	C	A	7: 102,535,280	H178N	probably benign	Het
Olfr585	T	C	7: 103,098,184	S148P	probably damaging	Het
Pcdh17	C	T	14: 84,447,259	Q389*	probably null	Het
Pik3r2	G	A	8: 70,770,421	R452C	probably benign	Het
Prr14l	T	C	5: 32,830,345	E602G	probably damaging	Het
Rusc2	C	A	4: 43,416,424	Q577K	probably benign	Het
Sacm1l	T	A	9: 123,587,576	M534K	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slco4a1	C	T	2: 180,464,091	T22M	probably benign	Het
Svs1	C	T	6: 48,987,994	P312L	possibly damaging	Het
Tas2r104	A	T	6: 131,684,925	C274S	probably benign	Het
Tnrc6c	C	T	11: 117,723,529	R838W	probably damaging	Het
Trim43c	T	A	9: 88,840,401	H33Q	probably damaging	Het
Ttc17	A	T	2: 94,369,413	I411K	possibly damaging	Het
Ttn	G	T	2: 76,751,334	L23072I	possibly damaging	Het
Ttn	A	C	2: 76,955,024	V669G	possibly damaging	Het
Vmn1r60	A	T	7: 5,545,027	F25I	possibly damaging	Het
Vmn2r9	A	G	5: 108,848,131	I217T	probably damaging	Het

Other mutations in AY358078

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01327:AY358078	APN	14	51805709	splice site	probably benign
IGL02053:AY358078	APN	14	51805552	missense	unknown
IGL02057:AY358078	APN	14	51820305	missense	unknown
IGL02498:AY358078	APN	14	51803487	missense	probably benign	0.00
FR4737:AY358078	UTSW	14	51805698	missense	unknown
R0140:AY358078	UTSW	14	51825942	missense	probably benign	0.12
R0466:AY358078	UTSW	14	51805632	missense	unknown
R0496:AY358078	UTSW	14	51803532	missense	unknown
R1546:AY358078	UTSW	14	51820419	splice site	probably null
R1793:AY358078	UTSW	14	51804594	missense	unknown
R1867:AY358078	UTSW	14	51800047	start codon destroyed	probably null	0.01
R1993:AY358078	UTSW	14	51826062	missense	probably damaging	1.00
R1994:AY358078	UTSW	14	51826062	missense	probably damaging	1.00
R1995:AY358078	UTSW	14	51826062	missense	probably damaging	1.00
R2184:AY358078	UTSW	14	51825988	missense	probably damaging	1.00
R2322:AY358078	UTSW	14	51804690	missense	unknown
R2441:AY358078	UTSW	14	51800089	missense	probably benign	0.00
R3851:AY358078	UTSW	14	51805553	missense	unknown
R4600:AY358078	UTSW	14	51826075	missense	possibly damaging	0.89
R4603:AY358078	UTSW	14	51826075	missense	possibly damaging	0.89
R4610:AY358078	UTSW	14	51826075	missense	possibly damaging	0.89
R4611:AY358078	UTSW	14	51826075	missense	possibly damaging	0.89
R4916:AY358078	UTSW	14	51802651	missense	unknown
R5096:AY358078	UTSW	14	51826118	missense	probably benign	0.19
R5143:AY358078	UTSW	14	51802549	missense	unknown
R5609:AY358078	UTSW	14	51804608	missense	unknown
R5651:AY358078	UTSW	14	51822160	missense	unknown
R6345:AY358078	UTSW	14	51826292	missense	probably damaging	1.00
R6988:AY358078	UTSW	14	51826187	missense	probably damaging	0.99
R7340:AY358078	UTSW	14	51826259	missense	probably damaging	1.00
R8432:AY358078	UTSW	14	51822178	missense	unknown
R8684:AY358078	UTSW	14	51822140	nonsense	probably null
RF002:AY358078	UTSW	14	51805593	nonsense	probably null
RF017:AY358078	UTSW	14	51805593	nonsense	probably null
RF025:AY358078	UTSW	14	51805589	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGTACTTGGAGGAGTTACAGGC -3'
(R):5'- CACAGAAAGCCTTGTAGATGATACC -3'

Sequencing Primer
(F):5'- TGGAAGCTAGCTGGGAATCACC -3'
(R):5'- TACCCTAAATGAACACTTGAAGGAG -3'

Posted On

2015-10-16