Incidental Mutation 'R3934:Sod3'
ID 353160
Institutional Source Beutler Lab
Gene Symbol Sod3
Ensembl Gene ENSMUSG00000072941
Gene Name superoxide dismutase 3, extracellular
Synonyms EC-SOD
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R3934 (G1)
Quality Score 58
Status Validated
Chromosome 5
Chromosomal Location 52521146-52527080 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 52525987 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 229 (S229P)
Ref Sequence ENSEMBL: ENSMUSP00000098768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101208]
AlphaFold O09164
Predicted Effect probably benign
Transcript: ENSMUST00000101208
AA Change: S229P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098768
Gene: ENSMUSG00000072941
AA Change: S229P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Sod_Cu 85 224 1.5e-32 PFAM
low complexity region 233 251 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the superoxide dismutase (SOD) protein family. SODs are antioxidant enzymes that catalyze the conversion of superoxide radicals into hydrogen peroxide and oxygen, which may protect the brain, lungs, and other tissues from oxidative stress. Proteolytic processing of the encoded protein results in the formation of two distinct homotetramers that differ in their ability to interact with the extracellular matrix (ECM). Homotetramers consisting of the intact protein, or type C subunit, exhibit high affinity for heparin and are anchored to the ECM. Homotetramers consisting of a proteolytically cleaved form of the protein, or type A subunit, exhibit low affinity for heparin and do not interact with the ECM. A mutation in this gene may be associated with increased heart disease risk. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased sensitivity to hyperoxia, increased LPS-stimulated spleen production of TNF, and enhanced severity of collagen-induced arthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik T A 12: 18,584,082 (GRCm39) Y381N possibly damaging Het
Adgrf3 T C 5: 30,405,432 (GRCm39) probably benign Het
Adgrv1 A G 13: 81,623,166 (GRCm39) F3819S probably benign Het
Aig1 T C 10: 13,677,656 (GRCm39) D112G probably damaging Het
Akap6 C T 12: 53,187,227 (GRCm39) T1547M possibly damaging Het
Alk T A 17: 72,512,949 (GRCm39) I337F probably damaging Het
C2cd5 C T 6: 142,987,106 (GRCm39) V499I possibly damaging Het
Capn11 A T 17: 45,945,213 (GRCm39) probably benign Het
Clstn3 G A 6: 124,434,901 (GRCm39) T338I probably damaging Het
Cmbl A G 15: 31,589,933 (GRCm39) D221G possibly damaging Het
Enpp2 A G 15: 54,709,317 (GRCm39) V766A probably benign Het
Fastk G T 5: 24,647,257 (GRCm39) S317* probably null Het
Fgfr1op2 T A 6: 146,496,669 (GRCm39) probably benign Het
Gpr85 A G 6: 13,836,044 (GRCm39) F287L probably benign Het
Hectd4 G A 5: 121,458,164 (GRCm39) probably null Het
Hmcn2 T A 2: 31,270,496 (GRCm39) probably null Het
Hspbp1 A T 7: 4,667,594 (GRCm39) M271K probably benign Het
Itgb6 G A 2: 60,441,755 (GRCm39) T685M possibly damaging Het
Itih5 G A 2: 10,250,355 (GRCm39) V685I probably damaging Het
Kalrn T C 16: 34,130,901 (GRCm39) S421G probably benign Het
Mcm2 G A 6: 88,869,990 (GRCm39) R60C probably damaging Het
Mitf C T 6: 97,970,214 (GRCm39) P54S probably damaging Het
Perm1 A G 4: 156,303,627 (GRCm39) T724A probably benign Het
Pex5l T C 3: 33,061,321 (GRCm39) E176G probably damaging Het
Polk A T 13: 96,638,143 (GRCm39) M192K possibly damaging Het
Polr3a T C 14: 24,526,169 (GRCm39) I401V probably benign Het
Prpf38b T C 3: 108,811,741 (GRCm39) probably benign Het
Sema3c T C 5: 17,886,938 (GRCm39) S330P probably damaging Het
Slc16a7 C A 10: 125,066,712 (GRCm39) R309L probably damaging Het
Slc35f1 C T 10: 52,984,314 (GRCm39) T358I probably damaging Het
Slc39a12 T A 2: 14,439,174 (GRCm39) probably benign Het
Sorcs3 T A 19: 48,701,943 (GRCm39) V608D probably damaging Het
Spink5 G T 18: 44,149,494 (GRCm39) K958N probably damaging Het
Ttc7 A C 17: 87,678,166 (GRCm39) probably benign Het
Ush2a T A 1: 187,995,708 (GRCm39) probably null Het
Vmn2r19 T A 6: 123,292,628 (GRCm39) D223E probably damaging Het
Vwf T A 6: 125,532,462 (GRCm39) S87T probably damaging Het
Wdr35 G T 12: 9,058,014 (GRCm39) G513C probably damaging Het
Other mutations in Sod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Sod3 APN 5 52,525,540 (GRCm39) nonsense probably null
IGL02894:Sod3 APN 5 52,525,348 (GRCm39) missense possibly damaging 0.70
R0646:Sod3 UTSW 5 52,525,421 (GRCm39) missense probably benign 0.02
R1822:Sod3 UTSW 5 52,525,504 (GRCm39) missense probably benign 0.07
R1823:Sod3 UTSW 5 52,525,504 (GRCm39) missense probably benign 0.07
R1824:Sod3 UTSW 5 52,525,504 (GRCm39) missense probably benign 0.07
R3872:Sod3 UTSW 5 52,525,631 (GRCm39) missense probably damaging 0.98
R4969:Sod3 UTSW 5 52,525,736 (GRCm39) missense probably damaging 1.00
R6899:Sod3 UTSW 5 52,526,050 (GRCm39) missense unknown
R7773:Sod3 UTSW 5 52,525,643 (GRCm39) missense possibly damaging 0.94
R8964:Sod3 UTSW 5 52,525,696 (GRCm39) missense probably damaging 1.00
R9779:Sod3 UTSW 5 52,525,435 (GRCm39) missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- ACTTTGGCAACTTCGTGGTG -3'
(R):5'- TGGGTTAACTAAGGTGTCCTGGAC -3'

Sequencing Primer
(F):5'- AACTTCGTGGTGCGCAAC -3'
(R):5'- CATCTGGGGGCCATACAGAG -3'
Posted On 2015-10-16