Incidental Mutation 'R3934:Sod3'
ID353160
Institutional Source Beutler Lab
Gene Symbol Sod3
Ensembl Gene ENSMUSG00000072941
Gene Namesuperoxide dismutase 3, extracellular
SynonymsEC-SOD
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R3934 (G1)
Quality Score58
Status Validated
Chromosome5
Chromosomal Location52363791-52371418 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52368645 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 229 (S229P)
Ref Sequence ENSEMBL: ENSMUSP00000098768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000101208]
PDB Structure
[]
[]
Predicted Effect probably benign
Transcript: ENSMUST00000101208
AA Change: S229P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000098768
Gene: ENSMUSG00000072941
AA Change: S229P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Sod_Cu 85 224 1.5e-32 PFAM
low complexity region 233 251 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency 100% (40/40)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the superoxide dismutase (SOD) protein family. SODs are antioxidant enzymes that catalyze the conversion of superoxide radicals into hydrogen peroxide and oxygen, which may protect the brain, lungs, and other tissues from oxidative stress. Proteolytic processing of the encoded protein results in the formation of two distinct homotetramers that differ in their ability to interact with the extracellular matrix (ECM). Homotetramers consisting of the intact protein, or type C subunit, exhibit high affinity for heparin and are anchored to the ECM. Homotetramers consisting of a proteolytically cleaved form of the protein, or type A subunit, exhibit low affinity for heparin and do not interact with the ECM. A mutation in this gene may be associated with increased heart disease risk. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased sensitivity to hyperoxia, increased LPS-stimulated spleen production of TNF, and enhanced severity of collagen-induced arthritis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730507C01Rik T A 12: 18,534,081 Y381N possibly damaging Het
Adgrf3 T C 5: 30,200,434 probably benign Het
Adgrv1 A G 13: 81,475,047 F3819S probably benign Het
Aig1 T C 10: 13,801,912 D112G probably damaging Het
Akap6 C T 12: 53,140,444 T1547M possibly damaging Het
Alk T A 17: 72,205,954 I337F probably damaging Het
C2cd5 C T 6: 143,041,380 V499I possibly damaging Het
Capn11 A T 17: 45,634,287 probably benign Het
Clstn3 G A 6: 124,457,942 T338I probably damaging Het
Cmbl A G 15: 31,589,787 D221G possibly damaging Het
Enpp2 A G 15: 54,845,921 V766A probably benign Het
Fastk G T 5: 24,442,259 S317* probably null Het
Fgfr1op2 T A 6: 146,595,171 probably benign Het
Gpr85 A G 6: 13,836,045 F287L probably benign Het
Hectd4 G A 5: 121,320,101 probably null Het
Hmcn2 T A 2: 31,380,484 probably null Het
Hspbp1 A T 7: 4,664,595 M271K probably benign Het
Itgb6 G A 2: 60,611,411 T685M possibly damaging Het
Itih5 G A 2: 10,245,544 V685I probably damaging Het
Kalrn T C 16: 34,310,531 S421G probably benign Het
Mcm2 G A 6: 88,893,008 R60C probably damaging Het
Mitf C T 6: 97,993,253 P54S probably damaging Het
Perm1 A G 4: 156,219,170 T724A probably benign Het
Pex5l T C 3: 33,007,172 E176G probably damaging Het
Polk A T 13: 96,501,635 M192K possibly damaging Het
Polr3a T C 14: 24,476,101 I401V probably benign Het
Prpf38b T C 3: 108,904,425 probably benign Het
Sema3c T C 5: 17,681,940 S330P probably damaging Het
Slc16a7 C A 10: 125,230,843 R309L probably damaging Het
Slc35f1 C T 10: 53,108,218 T358I probably damaging Het
Slc39a12 T A 2: 14,434,363 probably benign Het
Sorcs3 T A 19: 48,713,504 V608D probably damaging Het
Spink5 G T 18: 44,016,427 K958N probably damaging Het
Ttc7 A C 17: 87,370,738 probably benign Het
Ush2a T A 1: 188,263,511 probably null Het
Vmn2r19 T A 6: 123,315,669 D223E probably damaging Het
Vwf T A 6: 125,555,499 S87T probably damaging Het
Wdr35 G T 12: 9,008,014 G513C probably damaging Het
Other mutations in Sod3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01074:Sod3 APN 5 52368198 nonsense probably null
IGL02894:Sod3 APN 5 52368006 missense possibly damaging 0.70
R0646:Sod3 UTSW 5 52368079 missense probably benign 0.02
R1822:Sod3 UTSW 5 52368162 missense probably benign 0.07
R1823:Sod3 UTSW 5 52368162 missense probably benign 0.07
R1824:Sod3 UTSW 5 52368162 missense probably benign 0.07
R3872:Sod3 UTSW 5 52368289 missense probably damaging 0.98
R4969:Sod3 UTSW 5 52368394 missense probably damaging 1.00
R6899:Sod3 UTSW 5 52368708 missense unknown
Predicted Primers PCR Primer
(F):5'- ACTTTGGCAACTTCGTGGTG -3'
(R):5'- TGGGTTAACTAAGGTGTCCTGGAC -3'

Sequencing Primer
(F):5'- AACTTCGTGGTGCGCAAC -3'
(R):5'- CATCTGGGGGCCATACAGAG -3'
Posted On2015-10-16