Incidental Mutation 'R3156:Col4a2'
ID353169
Institutional Source Beutler Lab
Gene Symbol Col4a2
Ensembl Gene ENSMUSG00000031503
Gene Namecollagen, type IV, alpha 2
SynonymsCol4a-2
MMRRC Submission 040607-MU
Accession Numbers

Genbank: NM_009932

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R3156 (G1)
Quality Score182
Status Validated
Chromosome8
Chromosomal Location11312805-11449287 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) T to A at 11313414 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000147951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033898] [ENSMUST00000033899] [ENSMUST00000209735]
Predicted Effect probably benign
Transcript: ENSMUST00000033898
SMART Domains Protein: ENSMUSP00000033898
Gene: ENSMUSG00000031502

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 28 43 N/A INTRINSIC
internal_repeat_2 49 89 2.1e-8 PROSPERO
Pfam:Collagen 103 163 6.1e-11 PFAM
Pfam:Collagen 167 225 7.8e-10 PFAM
low complexity region 232 248 N/A INTRINSIC
Pfam:Collagen 274 334 1.7e-11 PFAM
low complexity region 356 389 N/A INTRINSIC
low complexity region 404 426 N/A INTRINSIC
low complexity region 435 455 N/A INTRINSIC
Pfam:Collagen 472 533 7.3e-12 PFAM
Pfam:Collagen 539 597 4.8e-9 PFAM
low complexity region 600 636 N/A INTRINSIC
Pfam:Collagen 642 689 4.5e-8 PFAM
Pfam:Collagen 689 746 3.5e-8 PFAM
Pfam:Collagen 736 800 2.2e-9 PFAM
Pfam:Collagen 837 896 5.2e-11 PFAM
Pfam:Collagen 882 940 1.9e-10 PFAM
Pfam:Collagen 943 1007 1.7e-10 PFAM
Pfam:Collagen 996 1058 2e-9 PFAM
Pfam:Collagen 1057 1121 1.5e-10 PFAM
low complexity region 1133 1148 N/A INTRINSIC
Pfam:Collagen 1174 1233 8.6e-11 PFAM
low complexity region 1236 1266 N/A INTRINSIC
Pfam:Collagen 1269 1337 1e-8 PFAM
Pfam:Collagen 1290 1354 2.2e-9 PFAM
Pfam:Collagen 1384 1443 1e-10 PFAM
C4 1445 1554 3.49e-65 SMART
C4 1555 1668 1.53e-79 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000033899
SMART Domains Protein: ENSMUSP00000033899
Gene: ENSMUSG00000031503

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Collagen 56 119 1.2e-10 PFAM
Pfam:Collagen 112 174 3.9e-8 PFAM
low complexity region 193 229 N/A INTRINSIC
Pfam:Collagen 289 348 1.3e-10 PFAM
low complexity region 370 389 N/A INTRINSIC
low complexity region 427 445 N/A INTRINSIC
Pfam:Collagen 488 546 2e-10 PFAM
Pfam:Collagen 590 655 4.5e-9 PFAM
low complexity region 665 673 N/A INTRINSIC
Pfam:Collagen 674 731 3.5e-10 PFAM
Pfam:Collagen 714 775 4.3e-10 PFAM
Pfam:Collagen 773 831 1.5e-10 PFAM
Pfam:Collagen 861 935 8.1e-10 PFAM
Pfam:Collagen 915 976 1.1e-9 PFAM
Pfam:Collagen 978 1038 2.6e-8 PFAM
Pfam:Collagen 1027 1091 1.7e-10 PFAM
Pfam:Collagen 1094 1155 5.5e-11 PFAM
Pfam:Collagen 1147 1211 1e-10 PFAM
Pfam:Collagen 1271 1340 2.1e-8 PFAM
Pfam:Collagen 1330 1392 7.1e-10 PFAM
C4 1484 1591 7.85e-59 SMART
C4 1592 1706 7.65e-71 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000209735
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 98% (39/40)
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of the type IV collagens, an essential component of basement membranes. The encoded protein forms a triple helical heterotrimer comprised of alpha-1 and alpha-2 subunits that assembles into a type IV collagen network. Canstatin, a peptide derived fom the C-terminus of the collagen chain, is a matrikine that has been shown to inhibit angiogenesis. Homozygous knockout mice for this gene exhibit impaired basement membrane integrity and embryonic lethality. This gene shares a bi-directional promoter with a related gene on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: ENU-induced missense mutations of this gene result in a variable phenotype affecting the eye, brain and vascular stability in heterozygotes, and fetal or postnatal survival in homozygotes. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Gene trapped(6) Chemically induced(3)

Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310007B03Rik T A 1: 93,160,042 I30F possibly damaging Het
4933407L21Rik T C 1: 85,931,383 probably benign Het
Adra2b T C 2: 127,363,650 L29P probably damaging Het
Anxa9 A T 3: 95,302,405 D134E probably benign Het
Atad1 A T 19: 32,706,955 N14K probably benign Het
Cbl T C 9: 44,158,850 I533M possibly damaging Het
Cdca2 T C 14: 67,698,163 N368D possibly damaging Het
Cfap45 A T 1: 172,545,724 N543Y possibly damaging Het
Dis3l T C 9: 64,311,750 T633A probably benign Het
Dnah5 G A 15: 28,438,091 probably benign Het
Fut2 A T 7: 45,650,667 L227Q probably damaging Het
Gcnt2 T C 13: 40,861,178 V275A probably benign Het
Glrp1 C A 1: 88,503,254 Q131H unknown Het
Gm6871 T C 7: 41,573,655 N3S probably benign Het
Hmgcs1 C T 13: 119,705,078 T402I probably benign Het
Hps6 A G 19: 46,003,741 D39G probably damaging Het
Mycbp2 A T 14: 103,208,743 probably benign Het
Myh6 A G 14: 54,944,668 I1761T probably damaging Het
Neo1 T C 9: 58,888,979 probably null Het
Olfr726 T C 14: 50,084,525 D52G probably benign Het
Olfr845 A G 9: 19,339,424 probably null Het
Patj A G 4: 98,674,228 E1478G probably damaging Het
Paxbp1 T C 16: 91,035,990 T304A probably benign Het
Rbp3 A T 14: 33,957,114 K1006N probably damaging Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Ror2 G T 13: 53,117,364 N306K probably damaging Het
Rusc1 T C 3: 89,091,731 D248G probably benign Het
Secisbp2 A G 13: 51,662,675 T288A probably benign Het
Setbp1 A G 18: 78,859,303 V383A probably benign Het
Sez6 T A 11: 77,953,779 S143T possibly damaging Het
Slc5a9 A T 4: 111,890,224 I322N possibly damaging Het
Szt2 A G 4: 118,402,819 probably null Het
Tex2 A G 11: 106,533,869 probably null Het
Tonsl A T 15: 76,639,521 L64Q probably damaging Het
Triml2 A G 8: 43,187,679 N191D probably benign Het
Trpc1 C T 9: 95,721,132 probably null Het
Yeats4 C T 10: 117,222,281 V22I probably benign Het
Other mutations in Col4a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Col4a2 APN 8 11443685 missense probably damaging 1.00
IGL00485:Col4a2 APN 8 11439012 missense probably benign
IGL00909:Col4a2 APN 8 11448167 missense possibly damaging 0.91
IGL01574:Col4a2 APN 8 11439306 missense probably damaging 1.00
IGL01914:Col4a2 APN 8 11414754 missense possibly damaging 0.57
IGL02147:Col4a2 APN 8 11408140 missense probably benign 0.28
IGL02205:Col4a2 APN 8 11431305 nonsense probably null
IGL02423:Col4a2 APN 8 11433800 missense probably benign
IGL03131:Col4a2 APN 8 11425979 missense probably benign
band UTSW 8 11448225 missense probably benign 0.00
binder UTSW 8 11416070 missense probably damaging 1.00
G4846:Col4a2 UTSW 8 11408872 splice site probably benign
IGL03054:Col4a2 UTSW 8 11448270 missense probably damaging 0.96
R0087:Col4a2 UTSW 8 11441296 missense probably benign
R0124:Col4a2 UTSW 8 11408871 splice site probably benign
R0603:Col4a2 UTSW 8 11414779 missense probably benign
R0646:Col4a2 UTSW 8 11431252 missense probably benign 0.17
R0970:Col4a2 UTSW 8 11415438 missense probably benign 0.00
R1738:Col4a2 UTSW 8 11446238 missense probably damaging 1.00
R1746:Col4a2 UTSW 8 11446020 missense probably benign 0.35
R1826:Col4a2 UTSW 8 11313509 critical splice donor site probably null
R1834:Col4a2 UTSW 8 11402997 missense probably benign 0.10
R2016:Col4a2 UTSW 8 11445086 missense probably benign 0.04
R2017:Col4a2 UTSW 8 11445086 missense probably benign 0.04
R2124:Col4a2 UTSW 8 11416070 missense probably damaging 1.00
R2137:Col4a2 UTSW 8 11433749 missense probably benign
R2207:Col4a2 UTSW 8 11443352 missense probably damaging 1.00
R4169:Col4a2 UTSW 8 11429391 missense probably benign 0.22
R4679:Col4a2 UTSW 8 11431337 missense possibly damaging 0.68
R4705:Col4a2 UTSW 8 11313504 missense possibly damaging 0.52
R4710:Col4a2 UTSW 8 11409462 missense probably benign 0.22
R4716:Col4a2 UTSW 8 11402224 missense probably damaging 1.00
R4730:Col4a2 UTSW 8 11437590 missense probably benign
R4732:Col4a2 UTSW 8 11414779 missense probably benign
R4732:Col4a2 UTSW 8 11446197 missense probably benign 0.02
R4733:Col4a2 UTSW 8 11414779 missense probably benign
R4733:Col4a2 UTSW 8 11446197 missense probably benign 0.02
R4834:Col4a2 UTSW 8 11406836 nonsense probably null
R4835:Col4a2 UTSW 8 11423570 nonsense probably null
R4953:Col4a2 UTSW 8 11429505 missense probably benign 0.02
R5078:Col4a2 UTSW 8 11443936 missense probably benign
R5204:Col4a2 UTSW 8 11398651 splice site probably null
R5221:Col4a2 UTSW 8 11448225 missense probably benign 0.00
R5355:Col4a2 UTSW 8 11445984 missense probably damaging 0.96
R5478:Col4a2 UTSW 8 11398697 missense probably benign 0.21
R5492:Col4a2 UTSW 8 11438608 missense possibly damaging 0.82
R5646:Col4a2 UTSW 8 11441281 missense probably damaging 1.00
R5857:Col4a2 UTSW 8 11425442 missense probably damaging 1.00
R5948:Col4a2 UTSW 8 11420600 missense probably benign 0.21
R6329:Col4a2 UTSW 8 11446238 missense probably damaging 1.00
R6496:Col4a2 UTSW 8 11402993 nonsense probably null
R6496:Col4a2 UTSW 8 11402994 missense probably damaging 1.00
R6531:Col4a2 UTSW 8 11408135 missense probably benign 0.00
R7185:Col4a2 UTSW 8 11399739 missense probably damaging 0.99
R7196:Col4a2 UTSW 8 11398693 missense probably damaging 1.00
R7266:Col4a2 UTSW 8 11425542 critical splice donor site probably null
R7308:Col4a2 UTSW 8 11406856 critical splice donor site probably null
R7341:Col4a2 UTSW 8 11398678 missense probably damaging 0.97
R7394:Col4a2 UTSW 8 11446184 missense probably benign 0.00
R7434:Col4a2 UTSW 8 11421250 missense probably damaging 1.00
R7606:Col4a2 UTSW 8 11443571 missense probably benign 0.00
R7646:Col4a2 UTSW 8 11445086 missense probably benign 0.04
R7712:Col4a2 UTSW 8 11425376 missense probably benign
Predicted Primers PCR Primer
(F):5'- AATAGGGATCGCGCTGCATG -3'
(R):5'- TGTCACAGTTGCTAGCAGC -3'

Sequencing Primer
(F):5'- TGCATGGGCTGAGGAGC -3'
(R):5'- CTAGCAGCAGCCACCTG -3'
Posted On2015-10-21