Mutagenetix > Incidental Mutations

Incidental Mutation 'R0271:Dip2c'

35318

Institutional Source

Beutler Lab

Gene Symbol

Dip2c

Ensembl Gene

ENSMUSG00000048264

Gene Name

disco interacting protein 2 homolog C

Synonyms

2900024P20Rik

MMRRC Submission

038497-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.759) question?

Stock #

R0271 (G1)

Quality Score

215

Status

Validated

Chromosome

Chromosomal Location

9276528-9668928 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 9615775 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Glycine at position 950 (R950G)

Ref Sequence

ENSEMBL: ENSMUSP00000131238 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]

Predicted Effect

probably damaging
Transcript: ENSMUST00000166299
AA Change: R980G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264
AA Change: R980G

Domain	Start	End	E-Value	Type
DMAP_binding	7	120	3.55e-43	SMART
low complexity region	170	187	N/A	INTRINSIC
low complexity region	275	287	N/A	INTRINSIC
Pfam:AMP-binding	324	801	3.6e-23	PFAM
Pfam:AMP-binding	977	1451	1.5e-72	PFAM
low complexity region	1514	1526	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000169960
AA Change: R950G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264
AA Change: R950G

Domain	Start	End	E-Value	Type
DMAP_binding	7	176	3.02e-37	SMART
low complexity region	226	243	N/A	INTRINSIC
low complexity region	331	343	N/A	INTRINSIC
Pfam:AMP-binding	380	637	5.9e-10	PFAM
SCOP:d1lci__	675	875	2e-8	SMART
Pfam:AMP-binding	947	1421	1.2e-56	PFAM
low complexity region	1484	1496	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000174552
AA Change: R979G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264
AA Change: R979G

Domain	Start	End	E-Value	Type
DMAP_binding	7	120	3.55e-43	SMART
low complexity region	170	187	N/A	INTRINSIC
low complexity region	275	287	N/A	INTRINSIC
Pfam:AMP-binding	324	800	2.7e-20	PFAM
Pfam:AMP-binding	976	1450	1.3e-56	PFAM
low complexity region	1513	1525	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000222280
AA Change: R82G

Meta Mutation Damage Score

0.6942

Coding Region Coverage

1x: 98.5%
3x: 97.4%
10x: 95.2%
20x: 90.6%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 63 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810403A07Rik	T	C	3: 88,686,329		probably benign	Het
4930544D05Rik	A	G	11: 70,616,648	Q173R	possibly damaging	Het
Ampd2	C	T	3: 108,086,716		probably benign	Het
Ankrd17	T	C	5: 90,254,799	S1467G	possibly damaging	Het
Arhgap31	T	G	16: 38,602,510	S1065R	possibly damaging	Het
Arhgef19	G	T	4: 141,250,607	M542I	probably benign	Het
C7	T	C	15: 5,015,380	D392G	possibly damaging	Het
Ccdc138	G	A	10: 58,575,823	C671Y	probably damaging	Het
Cdh8	A	G	8: 99,111,715	S498P	possibly damaging	Het
Cpb2	T	A	14: 75,257,709		probably null	Het
Cwc22	A	C	2: 77,920,858	N389K	probably benign	Het
Dgkb	T	A	12: 38,228,026	L550Q	probably damaging	Het
Eml6	A	G	11: 29,848,949	V437A	possibly damaging	Het
Fanca	T	C	8: 123,272,441		probably benign	Het
Fgd2	C	G	17: 29,367,008	L189V	possibly damaging	Het
Foxred2	A	C	15: 77,943,390	S590A	possibly damaging	Het
Gm1110	A	G	9: 26,920,666	F63S	probably damaging	Het
Gm14496	A	T	2: 181,995,954	M274L	probably benign	Het
Gm7008	T	A	12: 40,223,560		probably benign	Het
Gm9922	T	A	14: 101,729,553		probably benign	Het
Gtf3c3	A	T	1: 54,428,812	M222K	possibly damaging	Het
Hspa1b	A	G	17: 34,958,832	V59A	probably benign	Het
Impg1	T	C	9: 80,386,879		probably benign	Het
Lpcat4	T	A	2: 112,243,245		probably null	Het
Mipol1	T	C	12: 57,460,954		probably benign	Het
Mrpl37	C	A	4: 107,066,461	R112L	possibly damaging	Het
Myo18b	T	C	5: 112,809,685	N1471D	possibly damaging	Het
Nes	G	A	3: 87,978,642	E1359K	possibly damaging	Het
Nipbl	A	T	15: 8,361,737	V251E	possibly damaging	Het
Nlrp1b	T	C	11: 71,161,765	I946V	possibly damaging	Het
Obscn	T	G	11: 59,056,742		probably benign	Het
Olfr1024	A	T	2: 85,904,289	M255K	possibly damaging	Het
Olfr1239	T	A	2: 89,418,158	Y85F	probably benign	Het
Olfr1491	A	T	19: 13,705,135	T103S	probably benign	Het
Olfr635	T	A	7: 103,979,630	I146K	possibly damaging	Het
Pck2	T	C	14: 55,544,584		probably null	Het
Pcsk9	A	G	4: 106,449,049		probably benign	Het
Phyhd1	A	T	2: 30,269,822	Q56L	probably benign	Het
Plxnc1	C	T	10: 94,837,918	G1001S	probably null	Het
Prss52	T	C	14: 64,113,678	V304A	probably benign	Het
Prss55	C	T	14: 64,075,607	G276D	probably benign	Het
Pzp	A	T	6: 128,519,514	Y252N	probably damaging	Het
Rad1	T	C	15: 10,490,457		probably null	Het
Ripply3	A	T	16: 94,335,757	E92D	possibly damaging	Het
Rpp30	T	A	19: 36,104,403	D255E	probably benign	Het
Rsad1	T	C	11: 94,548,464		probably benign	Het
Serpini2	A	G	3: 75,246,578	M358T	probably damaging	Het
Slc35a1	T	A	4: 34,664,125	E331V	probably benign	Het
Slc38a7	A	G	8: 95,845,878	F179L	probably damaging	Het
Stmn4	C	T	14: 66,356,283	Q42*	probably null	Het
Sytl2	T	C	7: 90,403,020		probably benign	Het
Tab2	G	A	10: 7,919,158	A520V	probably benign	Het
Tcp10a	A	G	17: 7,331,156	I162M	probably benign	Het
Tmprss13	A	G	9: 45,333,688		probably benign	Het
Tnfrsf14	A	G	4: 154,926,597		probably null	Het
Tpx2	A	G	2: 152,867,367		probably benign	Het
Vmn2r105	T	A	17: 20,234,703	N57I	probably damaging	Het
Wars	C	T	12: 108,875,193	V220I	probably benign	Het
Washc1	T	A	17: 66,116,719	D212E	possibly damaging	Het
Wdr17	C	T	8: 54,693,096	A90T	possibly damaging	Het
Wdr43	A	G	17: 71,626,825	D139G	probably benign	Het
Zfp235	A	T	7: 24,137,131	H34L	possibly damaging	Het
Zkscan16	G	A	4: 58,952,391	V230I	probably benign	Het

Other mutations in Dip2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Dip2c	APN	13	9493108	missense	probably damaging	0.97
IGL00426:Dip2c	APN	13	9606515	missense	probably damaging	1.00
IGL00503:Dip2c	APN	13	9567898	missense	probably damaging	1.00
IGL00586:Dip2c	APN	13	9610755	missense	probably damaging	1.00
IGL01306:Dip2c	APN	13	9575143	missense	possibly damaging	0.72
IGL01580:Dip2c	APN	13	9637088	splice site	probably null
IGL01985:Dip2c	APN	13	9553267	splice site	probably benign
IGL02060:Dip2c	APN	13	9622630	missense	probably damaging	0.98
IGL02122:Dip2c	APN	13	9506659	missense	possibly damaging	0.48
IGL02170:Dip2c	APN	13	9606335	missense	probably benign	0.03
IGL02211:Dip2c	APN	13	9610847	missense	probably damaging	1.00
IGL02755:Dip2c	APN	13	9550320	critical splice donor site	probably null
IGL02836:Dip2c	APN	13	9610790	missense	probably damaging	0.98
IGL02935:Dip2c	APN	13	9662146	missense	probably damaging	1.00
IGL03032:Dip2c	APN	13	9551778	missense	probably damaging	1.00
ANU23:Dip2c	UTSW	13	9575143	missense	possibly damaging	0.72
P0038:Dip2c	UTSW	13	9646982	missense	probably damaging	1.00
R0009:Dip2c	UTSW	13	9621903	missense	probably damaging	1.00
R0268:Dip2c	UTSW	13	9637150	missense	probably damaging	1.00
R0306:Dip2c	UTSW	13	9604599	missense	probably benign	0.09
R0415:Dip2c	UTSW	13	9568289	splice site	probably benign
R0519:Dip2c	UTSW	13	9563208	missense	probably damaging	1.00
R0557:Dip2c	UTSW	13	9553459	missense	possibly damaging	0.81
R0964:Dip2c	UTSW	13	9568663	missense	probably benign	0.43
R0973:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R0973:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R0974:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R1101:Dip2c	UTSW	13	9634744	missense	probably damaging	1.00
R1171:Dip2c	UTSW	13	9493126	missense	possibly damaging	0.89
R1403:Dip2c	UTSW	13	9553264	splice site	probably null
R1403:Dip2c	UTSW	13	9553264	splice site	probably null
R1432:Dip2c	UTSW	13	9553304	missense	probably damaging	0.99
R1481:Dip2c	UTSW	13	9551866	critical splice donor site	probably null
R1588:Dip2c	UTSW	13	9665864	missense	probably damaging	1.00
R1721:Dip2c	UTSW	13	9659368	missense	probably damaging	1.00
R1726:Dip2c	UTSW	13	9575428	missense	probably damaging	1.00
R1867:Dip2c	UTSW	13	9621949	missense	possibly damaging	0.55
R1909:Dip2c	UTSW	13	9533350	missense	probably benign	0.00
R2013:Dip2c	UTSW	13	9567846	nonsense	probably null
R2022:Dip2c	UTSW	13	9551800	missense	probably damaging	1.00
R2517:Dip2c	UTSW	13	9609005	missense	probably damaging	1.00
R3746:Dip2c	UTSW	13	9601473	missense	probably damaging	1.00
R3794:Dip2c	UTSW	13	9604561	missense	probably damaging	0.99
R3884:Dip2c	UTSW	13	9551858	missense	probably damaging	1.00
R4019:Dip2c	UTSW	13	9614365	missense	probably damaging	0.99
R4110:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4111:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4113:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4256:Dip2c	UTSW	13	9609056	missense	probably damaging	1.00
R4300:Dip2c	UTSW	13	9610711	missense	probably damaging	1.00
R4494:Dip2c	UTSW	13	9571062	missense	possibly damaging	0.64
R4739:Dip2c	UTSW	13	9533339	missense	probably damaging	0.98
R4812:Dip2c	UTSW	13	9637130	nonsense	probably null
R4814:Dip2c	UTSW	13	9536860	missense	probably benign	0.07
R4816:Dip2c	UTSW	13	9575150	missense	probably benign	0.37
R4828:Dip2c	UTSW	13	9560679	missense	probably damaging	1.00
R4915:Dip2c	UTSW	13	9621869	splice site	probably null
R4917:Dip2c	UTSW	13	9621869	splice site	probably null
R4932:Dip2c	UTSW	13	9623972	missense	probably damaging	0.99
R4993:Dip2c	UTSW	13	9575223	nonsense	probably null
R5043:Dip2c	UTSW	13	9551827	missense	possibly damaging	0.80
R5349:Dip2c	UTSW	13	9622653	missense	probably damaging	1.00
R5744:Dip2c	UTSW	13	9568405	missense	probably damaging	1.00
R5840:Dip2c	UTSW	13	9506676	missense	possibly damaging	0.68
R6110:Dip2c	UTSW	13	9623766	missense	probably damaging	1.00
R6160:Dip2c	UTSW	13	9533254	missense	probably benign	0.01
R6161:Dip2c	UTSW	13	9647007	missense	probably damaging	1.00
R6477:Dip2c	UTSW	13	9623760	missense	probably damaging	1.00
R6522:Dip2c	UTSW	13	9575228	critical splice donor site	probably null
R6603:Dip2c	UTSW	13	9654588	splice site	probably null
R6658:Dip2c	UTSW	13	9493177	critical splice donor site	probably null
R6672:Dip2c	UTSW	13	9567830	critical splice acceptor site	probably null
R6697:Dip2c	UTSW	13	9621913	missense	probably damaging	1.00
R6991:Dip2c	UTSW	13	9551860	nonsense	probably null
R6991:Dip2c	UTSW	13	9634832	missense	probably damaging	1.00
R7018:Dip2c	UTSW	13	9659278	missense	probably damaging	1.00
R7053:Dip2c	UTSW	13	9610704	missense	probably damaging	1.00
R7102:Dip2c	UTSW	13	9604536	missense	probably benign	0.01
R7171:Dip2c	UTSW	13	9506648	missense	probably benign	0.34
R7371:Dip2c	UTSW	13	9592749	missense	probably benign	0.02
R7395:Dip2c	UTSW	13	9614377	missense	probably damaging	1.00
R7489:Dip2c	UTSW	13	9533312	missense	probably damaging	0.99
R7575:Dip2c	UTSW	13	9628012	missense	probably damaging	0.97
R7642:Dip2c	UTSW	13	9622705	critical splice donor site	probably null
R7687:Dip2c	UTSW	13	9604581	missense	probably benign	0.00
R7699:Dip2c	UTSW	13	9659311	missense	probably benign	0.00
R7700:Dip2c	UTSW	13	9659311	missense	probably benign	0.00
R7715:Dip2c	UTSW	13	9614391	missense	probably damaging	1.00
R7842:Dip2c	UTSW	13	9606533	critical splice donor site	probably null
R7845:Dip2c	UTSW	13	9609044	missense	probably damaging	1.00
R8354:Dip2c	UTSW	13	9621882	missense	probably benign	0.05
R8685:Dip2c	UTSW	13	9637125	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- CTGACTTGTGGAGAACTTGCCTAACC -3'
(R):5'- TCATTCCCTAGAGTCTGACAGTAAGCC -3'

Sequencing Primer
(F):5'- GTCTCAGTCAGATGCACTGAATG -3'
(R):5'- tgtccatttactgctttgctc -3'

Posted On

2013-05-09