Incidental Mutation 'R4710:Vmn2r4'
ID353192
Institutional Source Beutler Lab
Gene Symbol Vmn2r4
Ensembl Gene ENSMUSG00000092049
Gene Namevomeronasal 2, receptor 4
SynonymsEG637053
MMRRC Submission 042019-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.056) question?
Stock #R4710 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location64388621-64415296 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 64409780 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135228 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170280] [ENSMUST00000175724]
Predicted Effect probably null
Transcript: ENSMUST00000170280
SMART Domains Protein: ENSMUSP00000127513
Gene: ENSMUSG00000092049

DomainStartEndE-ValueType
Pfam:ANF_receptor 1 416 2.7e-72 PFAM
Pfam:Peripla_BP_6 61 240 1.9e-9 PFAM
Pfam:NCD3G 458 511 1.1e-17 PFAM
Pfam:7tm_3 542 779 1.8e-75 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000175724
SMART Domains Protein: ENSMUSP00000135228
Gene: ENSMUSG00000092049

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:ANF_receptor 88 505 2.3e-75 PFAM
Pfam:NCD3G 547 600 4.7e-17 PFAM
Pfam:7tm_3 633 867 8.2e-47 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (75/76)
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,641,303 Q185L probably benign Het
Acaca T A 11: 84,392,337 I2243N possibly damaging Het
Adamts18 A G 8: 113,706,926 S1059P probably damaging Het
Aox4 A T 1: 58,255,638 K1002M probably damaging Het
Ap1b1 A G 11: 5,031,664 Y524C probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bpifb6 T A 2: 153,908,516 I309N possibly damaging Het
Cd209b T C 8: 3,924,215 E99G probably damaging Het
Cntn2 T A 1: 132,528,225 H185L possibly damaging Het
Col4a2 C A 8: 11,409,462 P299Q probably benign Het
Commd3 A G 2: 18,674,282 N106S probably benign Het
Coro7 T G 16: 4,634,933 probably benign Het
Ctf1 C A 7: 127,717,080 P66Q probably damaging Het
Dclre1c T C 2: 3,440,861 probably null Het
Dnaaf3 A T 7: 4,526,494 L317Q probably damaging Het
Dnah2 A G 11: 69,478,077 L1667P probably damaging Het
Dpp4 A G 2: 62,360,315 I399T probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Erg T C 16: 95,390,034 D90G possibly damaging Het
F11 T C 8: 45,250,146 Y169C probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fcgbp A T 7: 28,094,961 M1197L probably benign Het
Gimd1 T C 3: 132,634,848 S42P possibly damaging Het
Gm12666 T C 4: 92,190,975 E203G possibly damaging Het
Gm5526 T A 1: 45,857,419 noncoding transcript Het
Gnl2 T A 4: 125,053,459 S625T probably benign Het
H2-Q2 A G 17: 35,343,302 E175G probably damaging Het
Hmgxb3 G A 18: 61,137,475 P926S probably damaging Het
Ifi213 G A 1: 173,567,172 probably benign Het
Inhba T C 13: 16,026,483 V210A probably benign Het
Kansl1l G A 1: 66,801,496 A215V possibly damaging Het
Kcnk1 T A 8: 126,029,528 V263D probably damaging Het
Kcnk9 A G 15: 72,512,975 I118T probably damaging Het
Lamb1 A G 12: 31,282,583 I283V probably benign Het
Lias A G 5: 65,397,727 D88G probably benign Het
Lrrk2 G A 15: 91,699,927 V297M possibly damaging Het
Maea C T 5: 33,368,690 R237C probably benign Het
Mdfi T A 17: 47,824,586 N73I probably damaging Het
Mphosph6 T A 8: 117,801,902 M1L probably damaging Het
Mta2 T A 19: 8,949,153 I486N probably damaging Het
Nbr1 C T 11: 101,575,275 P769L probably damaging Het
Ncam2 T A 16: 81,465,706 probably null Het
Ndel1 A G 11: 68,845,337 Y26H probably damaging Het
Neb T C 2: 52,260,598 R2473G probably benign Het
Olfr1115 T A 2: 87,252,040 D34E possibly damaging Het
Olfr140 T C 2: 90,052,150 Y58C probably damaging Het
Olfr187 T A 16: 59,036,275 H154L possibly damaging Het
Olfr213 T C 6: 116,540,650 Y66H possibly damaging Het
Olfr325 A T 11: 58,581,722 I293F probably damaging Het
Olfr459 G T 6: 41,771,508 Q264K probably benign Het
Park2 A C 17: 11,854,833 Q346P possibly damaging Het
Prrc2b T A 2: 32,193,857 S236R possibly damaging Het
Rae1 G T 2: 173,015,392 probably benign Het
Rnf112 T C 11: 61,449,831 D491G probably damaging Het
Rnf220 C T 4: 117,289,214 probably benign Het
Ryr3 G A 2: 112,766,301 L2483F probably damaging Het
Sema6a T C 18: 47,270,683 N624S probably benign Het
Sgms1 C T 19: 32,160,137 V10M probably damaging Het
Slc23a2 T C 2: 132,056,709 N636S probably benign Het
Slc25a48 C T 13: 56,463,566 T162I probably damaging Het
Smtn G A 11: 3,524,663 S716F probably damaging Het
Snrnp200 T C 2: 127,226,133 L850P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sox18 A G 2: 181,670,895 Y148H probably damaging Het
Stk-ps1 A G 17: 36,397,670 noncoding transcript Het
Tas2r104 T A 6: 131,685,444 T101S probably damaging Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Ttn A G 2: 76,752,084 Y22822H probably damaging Het
Vmn2r53 T A 7: 12,601,202 H177L probably benign Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Zfat A T 15: 68,180,282 D554E probably benign Het
Zfp719 C T 7: 43,590,232 H415Y probably damaging Het
Other mutations in Vmn2r4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Vmn2r4 APN 3 64409779 splice site probably null
IGL01448:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01452:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01454:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01456:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01463:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01467:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01468:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01470:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01476:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01481:Vmn2r4 APN 3 64406395 missense probably damaging 0.99
IGL01534:Vmn2r4 APN 3 64406423 missense probably damaging 1.00
IGL01636:Vmn2r4 APN 3 64406236 missense probably benign 0.21
IGL01879:Vmn2r4 APN 3 64391010 missense probably damaging 1.00
IGL02147:Vmn2r4 APN 3 64398361 splice site probably benign
IGL02276:Vmn2r4 APN 3 64406456 missense possibly damaging 0.95
IGL02432:Vmn2r4 APN 3 64406400 missense probably benign 0.38
IGL02533:Vmn2r4 APN 3 64398419 nonsense probably null
IGL02655:Vmn2r4 APN 3 64398465 missense probably damaging 0.97
IGL02666:Vmn2r4 APN 3 64389012 missense probably benign 0.10
IGL02902:Vmn2r4 APN 3 64406916 missense probably benign 0.22
IGL03189:Vmn2r4 APN 3 64389168 missense possibly damaging 0.89
IGL03250:Vmn2r4 APN 3 64406642 missense probably damaging 1.00
IGL03271:Vmn2r4 APN 3 64398429 missense probably benign 0.01
R0310:Vmn2r4 UTSW 3 64389434 nonsense probably null
R0504:Vmn2r4 UTSW 3 64389363 missense probably damaging 1.00
R1546:Vmn2r4 UTSW 3 64406888 missense probably damaging 1.00
R1562:Vmn2r4 UTSW 3 64389444 missense probably damaging 0.98
R1863:Vmn2r4 UTSW 3 64406989 missense probably benign 0.33
R1873:Vmn2r4 UTSW 3 64391058 missense possibly damaging 0.93
R1939:Vmn2r4 UTSW 3 64398555 missense probably benign 0.00
R2103:Vmn2r4 UTSW 3 64415283 missense possibly damaging 0.48
R3083:Vmn2r4 UTSW 3 64389367 missense probably damaging 1.00
R3687:Vmn2r4 UTSW 3 64389475 missense possibly damaging 0.93
R3707:Vmn2r4 UTSW 3 64389474 missense probably damaging 0.99
R3963:Vmn2r4 UTSW 3 64415151 missense probably damaging 0.99
R4428:Vmn2r4 UTSW 3 64415169 missense probably damaging 1.00
R4737:Vmn2r4 UTSW 3 64409963 missense probably damaging 1.00
R4767:Vmn2r4 UTSW 3 64390976 missense probably damaging 0.99
R4776:Vmn2r4 UTSW 3 64388661 missense probably damaging 0.96
R4834:Vmn2r4 UTSW 3 64410063 missense probably benign 0.40
R4893:Vmn2r4 UTSW 3 64406255 missense probably damaging 0.96
R4908:Vmn2r4 UTSW 3 64389055 missense possibly damaging 0.59
R5049:Vmn2r4 UTSW 3 64398598 splice site probably null
R5092:Vmn2r4 UTSW 3 64390952 missense probably benign 0.01
R5234:Vmn2r4 UTSW 3 64398457 missense possibly damaging 0.88
R5240:Vmn2r4 UTSW 3 64406937 missense possibly damaging 0.53
R5704:Vmn2r4 UTSW 3 64409949 missense probably benign 0.03
R5897:Vmn2r4 UTSW 3 64415266 nonsense probably null
R5907:Vmn2r4 UTSW 3 64391066 missense probably damaging 0.99
R5924:Vmn2r4 UTSW 3 64389264 missense probably damaging 1.00
R6145:Vmn2r4 UTSW 3 64406943 missense probably benign 0.00
R6191:Vmn2r4 UTSW 3 64415281 missense probably benign 0.34
R6192:Vmn2r4 UTSW 3 64415278 missense probably benign 0.00
R6207:Vmn2r4 UTSW 3 64406505 missense probably damaging 1.00
R6457:Vmn2r4 UTSW 3 64409957 missense probably damaging 1.00
R6533:Vmn2r4 UTSW 3 64415098 missense probably benign
R6545:Vmn2r4 UTSW 3 64406356 missense possibly damaging 0.50
R6594:Vmn2r4 UTSW 3 64389310 missense probably damaging 1.00
R7049:Vmn2r4 UTSW 3 64389129 missense probably benign 0.14
R7150:Vmn2r4 UTSW 3 64398477 missense probably benign 0.01
R7187:Vmn2r4 UTSW 3 64415260 missense probably benign 0.00
R7363:Vmn2r4 UTSW 3 64407011 missense probably damaging 1.00
R7477:Vmn2r4 UTSW 3 64398429 missense probably benign 0.01
R7675:Vmn2r4 UTSW 3 64415236 missense probably benign 0.01
R7858:Vmn2r4 UTSW 3 64409805 missense probably benign 0.00
R7888:Vmn2r4 UTSW 3 64406522 missense probably damaging 0.99
R7941:Vmn2r4 UTSW 3 64409805 missense probably benign 0.00
R7971:Vmn2r4 UTSW 3 64406522 missense probably damaging 0.99
X0019:Vmn2r4 UTSW 3 64406636 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TAGCTTAGTGCAGCATCTCTG -3'
(R):5'- TCACCAAAGCAATGGAGTCATC -3'

Sequencing Primer
(F):5'- GCAGCATCTCTGGACCTCATAG -3'
(R):5'- CATCTTCAGTGTTTCTAACAGGGCAG -3'
Posted On2015-10-21