Incidental Mutation 'R4710:Col4a2'
ID353211
Institutional Source Beutler Lab
Gene Symbol Col4a2
Ensembl Gene ENSMUSG00000031503
Gene Namecollagen, type IV, alpha 2
SynonymsCol4a-2
MMRRC Submission 042019-MU
Accession Numbers

Genbank: NM_009932

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4710 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location11312805-11449287 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 11409462 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 299 (P299Q)
Ref Sequence ENSEMBL: ENSMUSP00000033899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033899]
Predicted Effect probably benign
Transcript: ENSMUST00000033899
AA Change: P299Q

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033899
Gene: ENSMUSG00000031503
AA Change: P299Q

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Collagen 56 119 1.2e-10 PFAM
Pfam:Collagen 112 174 3.9e-8 PFAM
low complexity region 193 229 N/A INTRINSIC
Pfam:Collagen 289 348 1.3e-10 PFAM
low complexity region 370 389 N/A INTRINSIC
low complexity region 427 445 N/A INTRINSIC
Pfam:Collagen 488 546 2e-10 PFAM
Pfam:Collagen 590 655 4.5e-9 PFAM
low complexity region 665 673 N/A INTRINSIC
Pfam:Collagen 674 731 3.5e-10 PFAM
Pfam:Collagen 714 775 4.3e-10 PFAM
Pfam:Collagen 773 831 1.5e-10 PFAM
Pfam:Collagen 861 935 8.1e-10 PFAM
Pfam:Collagen 915 976 1.1e-9 PFAM
Pfam:Collagen 978 1038 2.6e-8 PFAM
Pfam:Collagen 1027 1091 1.7e-10 PFAM
Pfam:Collagen 1094 1155 5.5e-11 PFAM
Pfam:Collagen 1147 1211 1e-10 PFAM
Pfam:Collagen 1271 1340 2.1e-8 PFAM
Pfam:Collagen 1330 1392 7.1e-10 PFAM
C4 1484 1591 7.85e-59 SMART
C4 1592 1706 7.65e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145295
SMART Domains Protein: ENSMUSP00000114737
Gene: ENSMUSG00000031503

DomainStartEndE-ValueType
Pfam:Collagen 6 55 9.7e-8 PFAM
Pfam:Collagen 81 140 4.4e-12 PFAM
Pfam:Collagen 145 210 2.7e-8 PFAM
Pfam:Collagen 184 239 2.9e-8 PFAM
low complexity region 280 293 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148654
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.5%
Validation Efficiency 99% (75/76)
MGI Phenotype FUNCTION: This gene encodes the alpha-2 subunit of the type IV collagens, an essential component of basement membranes. The encoded protein forms a triple helical heterotrimer comprised of alpha-1 and alpha-2 subunits that assembles into a type IV collagen network. Canstatin, a peptide derived fom the C-terminus of the collagen chain, is a matrikine that has been shown to inhibit angiogenesis. Homozygous knockout mice for this gene exhibit impaired basement membrane integrity and embryonic lethality. This gene shares a bi-directional promoter with a related gene on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: ENU-induced missense mutations of this gene result in a variable phenotype affecting the eye, brain and vascular stability in heterozygotes, and fetal or postnatal survival in homozygotes. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Gene trapped(6) Chemically induced(3)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,641,303 Q185L probably benign Het
Acaca T A 11: 84,392,337 I2243N possibly damaging Het
Adamts18 A G 8: 113,706,926 S1059P probably damaging Het
Aox4 A T 1: 58,255,638 K1002M probably damaging Het
Ap1b1 A G 11: 5,031,664 Y524C probably damaging Het
Bag4 C T 8: 25,769,488 A228T probably benign Het
Bpifb6 T A 2: 153,908,516 I309N possibly damaging Het
Cd209b T C 8: 3,924,215 E99G probably damaging Het
Cntn2 T A 1: 132,528,225 H185L possibly damaging Het
Commd3 A G 2: 18,674,282 N106S probably benign Het
Coro7 T G 16: 4,634,933 probably benign Het
Ctf1 C A 7: 127,717,080 P66Q probably damaging Het
Dclre1c T C 2: 3,440,861 probably null Het
Dnaaf3 A T 7: 4,526,494 L317Q probably damaging Het
Dnah2 A G 11: 69,478,077 L1667P probably damaging Het
Dpp4 A G 2: 62,360,315 I399T probably benign Het
Dysf C A 6: 84,097,715 D499E probably damaging Het
Erg T C 16: 95,390,034 D90G possibly damaging Het
F11 T C 8: 45,250,146 Y169C probably damaging Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fcgbp A T 7: 28,094,961 M1197L probably benign Het
Gimd1 T C 3: 132,634,848 S42P possibly damaging Het
Gm12666 T C 4: 92,190,975 E203G possibly damaging Het
Gm5526 T A 1: 45,857,419 noncoding transcript Het
Gnl2 T A 4: 125,053,459 S625T probably benign Het
H2-Q2 A G 17: 35,343,302 E175G probably damaging Het
Hmgxb3 G A 18: 61,137,475 P926S probably damaging Het
Ifi213 G A 1: 173,567,172 probably benign Het
Inhba T C 13: 16,026,483 V210A probably benign Het
Kansl1l G A 1: 66,801,496 A215V possibly damaging Het
Kcnk1 T A 8: 126,029,528 V263D probably damaging Het
Kcnk9 A G 15: 72,512,975 I118T probably damaging Het
Lamb1 A G 12: 31,282,583 I283V probably benign Het
Lias A G 5: 65,397,727 D88G probably benign Het
Lrrk2 G A 15: 91,699,927 V297M possibly damaging Het
Maea C T 5: 33,368,690 R237C probably benign Het
Mdfi T A 17: 47,824,586 N73I probably damaging Het
Mphosph6 T A 8: 117,801,902 M1L probably damaging Het
Mta2 T A 19: 8,949,153 I486N probably damaging Het
Nbr1 C T 11: 101,575,275 P769L probably damaging Het
Ncam2 T A 16: 81,465,706 probably null Het
Ndel1 A G 11: 68,845,337 Y26H probably damaging Het
Neb T C 2: 52,260,598 R2473G probably benign Het
Olfr1115 T A 2: 87,252,040 D34E possibly damaging Het
Olfr140 T C 2: 90,052,150 Y58C probably damaging Het
Olfr187 T A 16: 59,036,275 H154L possibly damaging Het
Olfr213 T C 6: 116,540,650 Y66H possibly damaging Het
Olfr325 A T 11: 58,581,722 I293F probably damaging Het
Olfr459 G T 6: 41,771,508 Q264K probably benign Het
Park2 A C 17: 11,854,833 Q346P possibly damaging Het
Prrc2b T A 2: 32,193,857 S236R possibly damaging Het
Rae1 G T 2: 173,015,392 probably benign Het
Rnf112 T C 11: 61,449,831 D491G probably damaging Het
Rnf220 C T 4: 117,289,214 probably benign Het
Ryr3 G A 2: 112,766,301 L2483F probably damaging Het
Sema6a T C 18: 47,270,683 N624S probably benign Het
Sgms1 C T 19: 32,160,137 V10M probably damaging Het
Slc23a2 T C 2: 132,056,709 N636S probably benign Het
Slc25a48 C T 13: 56,463,566 T162I probably damaging Het
Smtn G A 11: 3,524,663 S716F probably damaging Het
Snrnp200 T C 2: 127,226,133 L850P probably damaging Het
Sost G A 11: 101,966,844 P44S probably damaging Het
Sox18 A G 2: 181,670,895 Y148H probably damaging Het
Stk-ps1 A G 17: 36,397,670 noncoding transcript Het
Tas2r104 T A 6: 131,685,444 T101S probably damaging Het
Traf3ip2 C T 10: 39,639,260 P345S possibly damaging Het
Ttn A G 2: 76,752,084 Y22822H probably damaging Het
Vmn2r4 A G 3: 64,409,780 probably null Het
Vmn2r53 T A 7: 12,601,202 H177L probably benign Het
Zbtb20 G T 16: 43,610,676 A517S probably damaging Het
Zfat A T 15: 68,180,282 D554E probably benign Het
Zfp719 C T 7: 43,590,232 H415Y probably damaging Het
Other mutations in Col4a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Col4a2 APN 8 11443685 missense probably damaging 1.00
IGL00485:Col4a2 APN 8 11439012 missense probably benign
IGL00909:Col4a2 APN 8 11448167 missense possibly damaging 0.91
IGL01574:Col4a2 APN 8 11439306 missense probably damaging 1.00
IGL01914:Col4a2 APN 8 11414754 missense possibly damaging 0.57
IGL02147:Col4a2 APN 8 11408140 missense probably benign 0.28
IGL02205:Col4a2 APN 8 11431305 nonsense probably null
IGL02423:Col4a2 APN 8 11433800 missense probably benign
IGL03131:Col4a2 APN 8 11425979 missense probably benign
band UTSW 8 11448225 missense probably benign 0.00
binder UTSW 8 11416070 missense probably damaging 1.00
G4846:Col4a2 UTSW 8 11408872 splice site probably benign
IGL03054:Col4a2 UTSW 8 11448270 missense probably damaging 0.96
R0087:Col4a2 UTSW 8 11441296 missense probably benign
R0124:Col4a2 UTSW 8 11408871 splice site probably benign
R0603:Col4a2 UTSW 8 11414779 missense probably benign
R0646:Col4a2 UTSW 8 11431252 missense probably benign 0.17
R0970:Col4a2 UTSW 8 11415438 missense probably benign 0.00
R1738:Col4a2 UTSW 8 11446238 missense probably damaging 1.00
R1746:Col4a2 UTSW 8 11446020 missense probably benign 0.35
R1826:Col4a2 UTSW 8 11313509 critical splice donor site probably null
R1834:Col4a2 UTSW 8 11402997 missense probably benign 0.10
R2016:Col4a2 UTSW 8 11445086 missense probably benign 0.04
R2017:Col4a2 UTSW 8 11445086 missense probably benign 0.04
R2124:Col4a2 UTSW 8 11416070 missense probably damaging 1.00
R2137:Col4a2 UTSW 8 11433749 missense probably benign
R2207:Col4a2 UTSW 8 11443352 missense probably damaging 1.00
R3156:Col4a2 UTSW 8 11313414 unclassified probably benign
R4169:Col4a2 UTSW 8 11429391 missense probably benign 0.22
R4679:Col4a2 UTSW 8 11431337 missense possibly damaging 0.68
R4705:Col4a2 UTSW 8 11313504 missense possibly damaging 0.52
R4716:Col4a2 UTSW 8 11402224 missense probably damaging 1.00
R4730:Col4a2 UTSW 8 11437590 missense probably benign
R4732:Col4a2 UTSW 8 11414779 missense probably benign
R4732:Col4a2 UTSW 8 11446197 missense probably benign 0.02
R4733:Col4a2 UTSW 8 11414779 missense probably benign
R4733:Col4a2 UTSW 8 11446197 missense probably benign 0.02
R4834:Col4a2 UTSW 8 11406836 nonsense probably null
R4835:Col4a2 UTSW 8 11423570 nonsense probably null
R4953:Col4a2 UTSW 8 11429505 missense probably benign 0.02
R5078:Col4a2 UTSW 8 11443936 missense probably benign
R5204:Col4a2 UTSW 8 11398651 splice site probably null
R5221:Col4a2 UTSW 8 11448225 missense probably benign 0.00
R5355:Col4a2 UTSW 8 11445984 missense probably damaging 0.96
R5478:Col4a2 UTSW 8 11398697 missense probably benign 0.21
R5492:Col4a2 UTSW 8 11438608 missense possibly damaging 0.82
R5646:Col4a2 UTSW 8 11441281 missense probably damaging 1.00
R5857:Col4a2 UTSW 8 11425442 missense probably damaging 1.00
R5948:Col4a2 UTSW 8 11420600 missense probably benign 0.21
R6329:Col4a2 UTSW 8 11446238 missense probably damaging 1.00
R6496:Col4a2 UTSW 8 11402993 nonsense probably null
R6496:Col4a2 UTSW 8 11402994 missense probably damaging 1.00
R6531:Col4a2 UTSW 8 11408135 missense probably benign 0.00
R7185:Col4a2 UTSW 8 11399739 missense probably damaging 0.99
R7196:Col4a2 UTSW 8 11398693 missense probably damaging 1.00
R7266:Col4a2 UTSW 8 11425542 critical splice donor site probably null
R7308:Col4a2 UTSW 8 11406856 critical splice donor site probably null
R7341:Col4a2 UTSW 8 11398678 missense probably damaging 0.97
R7394:Col4a2 UTSW 8 11446184 missense probably benign 0.00
R7434:Col4a2 UTSW 8 11421250 missense probably damaging 1.00
R7606:Col4a2 UTSW 8 11443571 missense probably benign 0.00
R7646:Col4a2 UTSW 8 11445086 missense probably benign 0.04
R7712:Col4a2 UTSW 8 11425376 missense probably benign
R7752:Col4a2 UTSW 8 11429358 missense probably benign 0.38
R7844:Col4a2 UTSW 8 11425453 nonsense probably null
R7901:Col4a2 UTSW 8 11429358 missense probably benign 0.38
R8186:Col4a2 UTSW 8 11425542 critical splice donor site probably null
R8331:Col4a2 UTSW 8 11413985 nonsense probably null
R8389:Col4a2 UTSW 8 11448132 missense probably damaging 1.00
R8547:Col4a2 UTSW 8 11429305 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TCACTAAGGGGCCTAGGAAG -3'
(R):5'- AAAACTTCAGCACCAGGGG -3'

Sequencing Primer
(F):5'- CCTAGGAAGGCTGCAGACTG -3'
(R):5'- CACATCTGAGAGATATCCCTGGTG -3'
Posted On2015-10-21