Mutagenetix > Incidental Mutations

Incidental Mutation 'R4710:Col4a2'

353211

Institutional Source

Beutler Lab

Gene Symbol

Col4a2

Ensembl Gene

ENSMUSG00000031503

Gene Name

collagen, type IV, alpha 2

Synonyms

Col4a-2

MMRRC Submission

042019-MU

Accession Numbers

Genbank: NM_009932

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4710 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11312805-11449287 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 11409462 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 299 (P299Q)

Ref Sequence

ENSEMBL: ENSMUSP00000033899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000033899]

Predicted Effect

probably benign
Transcript: ENSMUST00000033899
AA Change: P299Q

PolyPhen 2 Score 0.218 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000033899
Gene: ENSMUSG00000031503
AA Change: P299Q

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
Pfam:Collagen	56	119	1.2e-10	PFAM
Pfam:Collagen	112	174	3.9e-8	PFAM
low complexity region	193	229	N/A	INTRINSIC
Pfam:Collagen	289	348	1.3e-10	PFAM
low complexity region	370	389	N/A	INTRINSIC
low complexity region	427	445	N/A	INTRINSIC
Pfam:Collagen	488	546	2e-10	PFAM
Pfam:Collagen	590	655	4.5e-9	PFAM
low complexity region	665	673	N/A	INTRINSIC
Pfam:Collagen	674	731	3.5e-10	PFAM
Pfam:Collagen	714	775	4.3e-10	PFAM
Pfam:Collagen	773	831	1.5e-10	PFAM
Pfam:Collagen	861	935	8.1e-10	PFAM
Pfam:Collagen	915	976	1.1e-9	PFAM
Pfam:Collagen	978	1038	2.6e-8	PFAM
Pfam:Collagen	1027	1091	1.7e-10	PFAM
Pfam:Collagen	1094	1155	5.5e-11	PFAM
Pfam:Collagen	1147	1211	1e-10	PFAM
Pfam:Collagen	1271	1340	2.1e-8	PFAM
Pfam:Collagen	1330	1392	7.1e-10	PFAM
C4	1484	1591	7.85e-59	SMART
C4	1592	1706	7.65e-71	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000145295

SMART Domains

Protein: ENSMUSP00000114737
Gene: ENSMUSG00000031503

Domain	Start	End	E-Value	Type
Pfam:Collagen	6	55	9.7e-8	PFAM
Pfam:Collagen	81	140	4.4e-12	PFAM
Pfam:Collagen	145	210	2.7e-8	PFAM
Pfam:Collagen	184	239	2.9e-8	PFAM
low complexity region	280	293	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148654

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.9%
20x: 94.5%

Validation Efficiency

99% (75/76)

MGI Phenotype

FUNCTION: This gene encodes the alpha-2 subunit of the type IV collagens, an essential component of basement membranes. The encoded protein forms a triple helical heterotrimer comprised of alpha-1 and alpha-2 subunits that assembles into a type IV collagen network. Canstatin, a peptide derived fom the C-terminus of the collagen chain, is a matrikine that has been shown to inhibit angiogenesis. Homozygous knockout mice for this gene exhibit impaired basement membrane integrity and embryonic lethality. This gene shares a bi-directional promoter with a related gene on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: ENU-induced missense mutations of this gene result in a variable phenotype affecting the eye, brain and vascular stability in heterozygotes, and fetal or postnatal survival in homozygotes. [provided by MGI curators]

Allele List at MGI

All alleles(10) : Targeted, knock-out(1) Gene trapped(6) Chemically induced(3)

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	T	6: 121,641,303	Q185L	probably benign	Het
Acaca	T	A	11: 84,392,337	I2243N	possibly damaging	Het
Adamts18	A	G	8: 113,706,926	S1059P	probably damaging	Het
Aox4	A	T	1: 58,255,638	K1002M	probably damaging	Het
Ap1b1	A	G	11: 5,031,664	Y524C	probably damaging	Het
Bag4	C	T	8: 25,769,488	A228T	probably benign	Het
Bpifb6	T	A	2: 153,908,516	I309N	possibly damaging	Het
Cd209b	T	C	8: 3,924,215	E99G	probably damaging	Het
Cntn2	T	A	1: 132,528,225	H185L	possibly damaging	Het
Commd3	A	G	2: 18,674,282	N106S	probably benign	Het
Coro7	T	G	16: 4,634,933		probably benign	Het
Ctf1	C	A	7: 127,717,080	P66Q	probably damaging	Het
Dclre1c	T	C	2: 3,440,861		probably null	Het
Dnaaf3	A	T	7: 4,526,494	L317Q	probably damaging	Het
Dnah2	A	G	11: 69,478,077	L1667P	probably damaging	Het
Dpp4	A	G	2: 62,360,315	I399T	probably benign	Het
Dysf	C	A	6: 84,097,715	D499E	probably damaging	Het
Erg	T	C	16: 95,390,034	D90G	possibly damaging	Het
F11	T	C	8: 45,250,146	Y169C	probably damaging	Het
Fabp3	C	T	4: 130,312,387	T57I	probably benign	Het
Fcgbp	A	T	7: 28,094,961	M1197L	probably benign	Het
Gimd1	T	C	3: 132,634,848	S42P	possibly damaging	Het
Gm12666	T	C	4: 92,190,975	E203G	possibly damaging	Het
Gm5526	T	A	1: 45,857,419		noncoding transcript	Het
Gnl2	T	A	4: 125,053,459	S625T	probably benign	Het
H2-Q2	A	G	17: 35,343,302	E175G	probably damaging	Het
Hmgxb3	G	A	18: 61,137,475	P926S	probably damaging	Het
Ifi213	G	A	1: 173,567,172		probably benign	Het
Inhba	T	C	13: 16,026,483	V210A	probably benign	Het
Kansl1l	G	A	1: 66,801,496	A215V	possibly damaging	Het
Kcnk1	T	A	8: 126,029,528	V263D	probably damaging	Het
Kcnk9	A	G	15: 72,512,975	I118T	probably damaging	Het
Lamb1	A	G	12: 31,282,583	I283V	probably benign	Het
Lias	A	G	5: 65,397,727	D88G	probably benign	Het
Lrrk2	G	A	15: 91,699,927	V297M	possibly damaging	Het
Maea	C	T	5: 33,368,690	R237C	probably benign	Het
Mdfi	T	A	17: 47,824,586	N73I	probably damaging	Het
Mphosph6	T	A	8: 117,801,902	M1L	probably damaging	Het
Mta2	T	A	19: 8,949,153	I486N	probably damaging	Het
Nbr1	C	T	11: 101,575,275	P769L	probably damaging	Het
Ncam2	T	A	16: 81,465,706		probably null	Het
Ndel1	A	G	11: 68,845,337	Y26H	probably damaging	Het
Neb	T	C	2: 52,260,598	R2473G	probably benign	Het
Olfr1115	T	A	2: 87,252,040	D34E	possibly damaging	Het
Olfr140	T	C	2: 90,052,150	Y58C	probably damaging	Het
Olfr187	T	A	16: 59,036,275	H154L	possibly damaging	Het
Olfr213	T	C	6: 116,540,650	Y66H	possibly damaging	Het
Olfr325	A	T	11: 58,581,722	I293F	probably damaging	Het
Olfr459	G	T	6: 41,771,508	Q264K	probably benign	Het
Park2	A	C	17: 11,854,833	Q346P	possibly damaging	Het
Prrc2b	T	A	2: 32,193,857	S236R	possibly damaging	Het
Rae1	G	T	2: 173,015,392		probably benign	Het
Rnf112	T	C	11: 61,449,831	D491G	probably damaging	Het
Rnf220	C	T	4: 117,289,214		probably benign	Het
Ryr3	G	A	2: 112,766,301	L2483F	probably damaging	Het
Sema6a	T	C	18: 47,270,683	N624S	probably benign	Het
Sgms1	C	T	19: 32,160,137	V10M	probably damaging	Het
Slc23a2	T	C	2: 132,056,709	N636S	probably benign	Het
Slc25a48	C	T	13: 56,463,566	T162I	probably damaging	Het
Smtn	G	A	11: 3,524,663	S716F	probably damaging	Het
Snrnp200	T	C	2: 127,226,133	L850P	probably damaging	Het
Sost	G	A	11: 101,966,844	P44S	probably damaging	Het
Sox18	A	G	2: 181,670,895	Y148H	probably damaging	Het
Stk-ps1	A	G	17: 36,397,670		noncoding transcript	Het
Tas2r104	T	A	6: 131,685,444	T101S	probably damaging	Het
Traf3ip2	C	T	10: 39,639,260	P345S	possibly damaging	Het
Ttn	A	G	2: 76,752,084	Y22822H	probably damaging	Het
Vmn2r4	A	G	3: 64,409,780		probably null	Het
Vmn2r53	T	A	7: 12,601,202	H177L	probably benign	Het
Zbtb20	G	T	16: 43,610,676	A517S	probably damaging	Het
Zfat	A	T	15: 68,180,282	D554E	probably benign	Het
Zfp719	C	T	7: 43,590,232	H415Y	probably damaging	Het

Other mutations in Col4a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Col4a2	APN	8	11443685	missense	probably damaging	1.00
IGL00485:Col4a2	APN	8	11439012	missense	probably benign
IGL00909:Col4a2	APN	8	11448167	missense	possibly damaging	0.91
IGL01574:Col4a2	APN	8	11439306	missense	probably damaging	1.00
IGL01914:Col4a2	APN	8	11414754	missense	possibly damaging	0.57
IGL02147:Col4a2	APN	8	11408140	missense	probably benign	0.28
IGL02205:Col4a2	APN	8	11431305	nonsense	probably null
IGL02423:Col4a2	APN	8	11433800	missense	probably benign
IGL03131:Col4a2	APN	8	11425979	missense	probably benign
band	UTSW	8	11448225	missense	probably benign	0.00
binder	UTSW	8	11416070	missense	probably damaging	1.00
G4846:Col4a2	UTSW	8	11408872	splice site	probably benign
IGL03054:Col4a2	UTSW	8	11448270	missense	probably damaging	0.96
R0087:Col4a2	UTSW	8	11441296	missense	probably benign
R0124:Col4a2	UTSW	8	11408871	splice site	probably benign
R0603:Col4a2	UTSW	8	11414779	missense	probably benign
R0646:Col4a2	UTSW	8	11431252	missense	probably benign	0.17
R0970:Col4a2	UTSW	8	11415438	missense	probably benign	0.00
R1738:Col4a2	UTSW	8	11446238	missense	probably damaging	1.00
R1746:Col4a2	UTSW	8	11446020	missense	probably benign	0.35
R1826:Col4a2	UTSW	8	11313509	critical splice donor site	probably null
R1834:Col4a2	UTSW	8	11402997	missense	probably benign	0.10
R2016:Col4a2	UTSW	8	11445086	missense	probably benign	0.04
R2017:Col4a2	UTSW	8	11445086	missense	probably benign	0.04
R2124:Col4a2	UTSW	8	11416070	missense	probably damaging	1.00
R2137:Col4a2	UTSW	8	11433749	missense	probably benign
R2207:Col4a2	UTSW	8	11443352	missense	probably damaging	1.00
R3156:Col4a2	UTSW	8	11313414	unclassified	probably benign
R4169:Col4a2	UTSW	8	11429391	missense	probably benign	0.22
R4679:Col4a2	UTSW	8	11431337	missense	possibly damaging	0.68
R4705:Col4a2	UTSW	8	11313504	missense	possibly damaging	0.52
R4716:Col4a2	UTSW	8	11402224	missense	probably damaging	1.00
R4730:Col4a2	UTSW	8	11437590	missense	probably benign
R4732:Col4a2	UTSW	8	11414779	missense	probably benign
R4732:Col4a2	UTSW	8	11446197	missense	probably benign	0.02
R4733:Col4a2	UTSW	8	11414779	missense	probably benign
R4733:Col4a2	UTSW	8	11446197	missense	probably benign	0.02
R4834:Col4a2	UTSW	8	11406836	nonsense	probably null
R4835:Col4a2	UTSW	8	11423570	nonsense	probably null
R4953:Col4a2	UTSW	8	11429505	missense	probably benign	0.02
R5078:Col4a2	UTSW	8	11443936	missense	probably benign
R5204:Col4a2	UTSW	8	11398651	splice site	probably null
R5221:Col4a2	UTSW	8	11448225	missense	probably benign	0.00
R5355:Col4a2	UTSW	8	11445984	missense	probably damaging	0.96
R5478:Col4a2	UTSW	8	11398697	missense	probably benign	0.21
R5492:Col4a2	UTSW	8	11438608	missense	possibly damaging	0.82
R5646:Col4a2	UTSW	8	11441281	missense	probably damaging	1.00
R5857:Col4a2	UTSW	8	11425442	missense	probably damaging	1.00
R5948:Col4a2	UTSW	8	11420600	missense	probably benign	0.21
R6329:Col4a2	UTSW	8	11446238	missense	probably damaging	1.00
R6496:Col4a2	UTSW	8	11402993	nonsense	probably null
R6496:Col4a2	UTSW	8	11402994	missense	probably damaging	1.00
R6531:Col4a2	UTSW	8	11408135	missense	probably benign	0.00
R7185:Col4a2	UTSW	8	11399739	missense	probably damaging	0.99
R7196:Col4a2	UTSW	8	11398693	missense	probably damaging	1.00
R7266:Col4a2	UTSW	8	11425542	critical splice donor site	probably null
R7308:Col4a2	UTSW	8	11406856	critical splice donor site	probably null
R7341:Col4a2	UTSW	8	11398678	missense	probably damaging	0.97
R7394:Col4a2	UTSW	8	11446184	missense	probably benign	0.00
R7434:Col4a2	UTSW	8	11421250	missense	probably damaging	1.00
R7606:Col4a2	UTSW	8	11443571	missense	probably benign	0.00
R7646:Col4a2	UTSW	8	11445086	missense	probably benign	0.04
R7712:Col4a2	UTSW	8	11425376	missense	probably benign
R7752:Col4a2	UTSW	8	11429358	missense	probably benign	0.38
R7844:Col4a2	UTSW	8	11425453	nonsense	probably null
R7901:Col4a2	UTSW	8	11429358	missense	probably benign	0.38
R8186:Col4a2	UTSW	8	11425542	critical splice donor site	probably null
R8331:Col4a2	UTSW	8	11413985	nonsense	probably null
R8389:Col4a2	UTSW	8	11448132	missense	probably damaging	1.00
R8547:Col4a2	UTSW	8	11429305	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- TCACTAAGGGGCCTAGGAAG -3'
(R):5'- AAAACTTCAGCACCAGGGG -3'

Sequencing Primer
(F):5'- CCTAGGAAGGCTGCAGACTG -3'
(R):5'- CACATCTGAGAGATATCCCTGGTG -3'

Posted On

2015-10-21